Differential expressions of endoplasmic reticulum stress-associated genes in aortic dissection and their correlation with immune cell infiltration

doi:10.12122/j.issn.1673-4254.2024.05.07

Abstract

Abstract:

Objective To explore differentially expressed endoplasmic reticulum stress-associated genes (ERSAGs) in aortic dissection (AD) and their correlations with immune cell infiltration to identify new therapeutic targets for AD. Methods Two AD mRNA expression datasets (GSE190635 and GSE98770) were downloaded from GEO database for analysis of differentially expressed genes between the aorta of AD patients and normal aorta using R software. ERSAGs dataset was downloaded from GeneCards website, and GeneMANIA database was used to analyze the protein-protein interaction network of the differentially expressed ERSAGs and the proteins interacting with these genes. Based on GSE98770 dataset we analyzed the distributions of 22 immune cells within the aortic wall of AD patients using CIBERSORT package of R software. Surgical aortic wall specimens were obtained from 10 AD patients and 10 non-AD patients for detecting AGER mRNA expression using qRT-PCR, and the upstream transcriptional factors, miRNAs, and chemicals targeting AGER were analyzed using the TRRUST database and NetworkAnalyst database. Results Bioinformatic analysis suggested significant differential expression of AGER in AD, which interacted with 20 proteins involved in pattern recognition receptor signaling pathway, positive regulation of DNA-binding transcription factor activity, myeloid leukocyte migration, leukocyte migration, and regulation of the I-κB kinase/NF-κB signaling. In AD, AGER expression level was positively correlated with Treg cell abundance (r=0.59, P<0.05). The results of qRT-PCR demonstrated significantly lower expression of AGER mRNA in AD than in non-AD patients (1.00±0.30 vs 1.76±0.68, P<0.05). ROC curve analysis showed that at the cut-off value of 1.335, AGER had an AUC of 0.86 (95% CI: 0.67-1.00, P=0.0073) for predicting AD. Three transcriptional factors, 3 miRNAs, and 27 chemicals were predicted in the AGER regulatory network. Conclusion AGER is lowly expressed in the aorta of AD patients and may influence the occurrence of AD through Treg cells.

Key words: aortic dissection, endoplasmic reticulum stress, immune cell infiltration, bioinformatics

Wei ZHOU, Jun NIE, Jia HU, Yizhi JIANG, Dafa ZHANG. Differential expressions of endoplasmic reticulum stress-associated genes in aortic dissection and their correlation with immune cell infiltration[J]. Journal of Southern Medical University, 2024, 44(5): 859-866.

Figures/Tables 8

Tab.1 Primer sequences for qRT-PCR

Primers

Sequence (5'-3')

β-Actin

F:AGCGAGCATCCCCCAAAGTT;

R:GGGCACGAAGGCTCATCATT

AGER

F: GTGTCCTTCCCAACGGCTC;

R: ATTGCCTGGCACCGGAAAA

Fig.1 Differentially expressed genes (DEGs) in AD. A: Volcano plot of the DEGs in GSE190635. Red points represent up-regulated genes, and blue points represent down-regulated genes; Black points represent genes without significant difference (NS). B: Heatmap of DEGs in GSE190635. C: Volcano plot for the DEGs in GSE98770. D: Heatmap of the DEGs in GSE98770.

Fig.2 Venn diagram of the DEGs in AD.

Fig.3 Protein-protein interaction network and functional analysis.

Fig.4 Immune cell infiltration analysis in the aorta of AD patients. A: CIBERSORT algorithm-based topography of the 22 immune cells in AD samples in GSE98770 dataset. B: Correlation analysis of the 22 immune cells. C: Correlation analysis of AGER with the 22 immune cells. D: Correlation analysis between Treg cell percentage and AGER expression level. Pearson method, *P<0.05.

Fig.5 Validation of AGER mRNA expression in clinical aorta specimens. A: qRT-PCR detection of AGER expression in AD and NAD groups. B: ROC curve analysis. **P<0.01.

Tab.2 Transcriptional factors （TF） of AGER

TF	Target	Type	PMID
NFKB1	AGER	Activation	18622638;19616578
PPARG	AGER	Repression	18855759
RELA	AGER	Activation	18622638;19616578

Fig.6 Prediction of upstream miRNAs (A) and regulatory chemicals (B) of AGER.

References 40

1	Mussa FF, Horton JD, Moridzadeh R, et al. Acute aortic dissection and intramural hematoma: a systematic review[J]. JAMA, 2016, 316(7): 754-63. DOI: 10.1001/jama.2016.10026
2	Qin H, Wu H, Chen Y, et al. Early detection of postoperative acute kidney injury in acute stanford type A aortic dissection with Doppler renal resistive index[J]. J Ultrasound Med, 2017, 36(10): 2105-11. DOI: 10.1002/jum.14236
3	Chiu P, Miller DC. Evolution of surgical therapy for Stanford acute type A aortic dissection[J]. Ann Cardiothorac Surg, 2016, 5(4): 275-95. DOI: 10.21037/acs.2016.05.05
4	Alfson DB, Ham SW. Type B aortic dissections: current guidelines for treatment[J]. Cardiol Clin, 2017, 35(3): 387-410. DOI: 10.1016/j.ccl.2017.03.007
5	Del Porto F, di Gioia C, Tritapepe L, et al. The multitasking role of macrophages in Stanford type A acute aortic dissection[J]. Cardiology, 2014, 127(2): 123-9. DOI: 10.1159/000355253
6	del Porto F, Proietta M, Tritapepe L, et al. Inflammation and immune response in acute aortic dissection[J]. Ann Med, 2010, 42(8): 622-9. DOI: 10.3109/07853890.2010.518156
7	Balch WE, Morimoto RI, Dillin A, et al. Adapting proteostasis for disease intervention [J]. Science, 2008, 319: 916-9. DOI: 10.1126/science.1141448
8	Hurtley SM, Bole DG, Hoover-Litty H, et al. Interactions of misfolded influenza virus hemagglutinin with binding protein (BiP)[J]. J Cell Biol, 1989, 108(6): 2117-26. DOI: 10.1083/jcb.108.6.2117
9	Smith MH, Ploegh HL, Weissman JS. Road to ruin: targeting proteins for degradation in the endoplasmic reticulum [J]. Science, 2011, 334: 1086-90. DOI: 10.1126/science.1209235
10	Travers KJ, Patil CK, Wodicka L, et al. Functional and genomic analyses reveal an essential coordination between the unfolded protein response and ER-associated degradation[J]. Cell, 2000, 101(3): 249-58. DOI: 10.1016/s0092-8674(00)80835-1
11	Wang L, Song RD, Ma MH, et al. Inhibition of autophagy can promote the apoptosis of bladder cancer cells induced by SC66 through the endoplasmic reticulum stress pathway[J]. Chem Biol Interact, 2023, 384: 110725. DOI: 10.1016/j.cbi.2023.110725
12	Choi SW, Cho W, Oh H, et al. Madecassoside ameliorates hepatic steatosis in high-fat diet-fed mice through AMPK/autophagy-mediated suppression of ER stress[J]. Biochem Pharmacol, 2023, 217: 115815. DOI: 10.1016/j.bcp.2023.115815
13	Zhu X, Chen X, Shen X, et al. PP4R1 accelerates the malignant progression of NSCLC via up-regulating HSPA6 expression and HSPA6-mediated ER stress[J]. Biochim Biophys Acta Mol Cell Res, 2024, 1871(1): 119588. DOI: 10.1016/j.bbamcr.2023.119588
14	Zhu ZW, Pu J, Li YN, et al. RBM25 regulates hypoxic cardiomyocyte apoptosis through CHOP-associated endoplasmic reticulum stress[J]. Cell Stress Chaperones, 2023, 28(6): 861-76. DOI: 10.1007/s12192-023-01380-7
15	Zhao Y, Liu Y, Deng J, et al. Ginsenoside F4 alleviates skeletal muscle insulin resistance by regulating PTP1B in type II diabetes mellitus[J]. J Agric Food Chem, 2023, 71(39): 14263-75. DOI: 10.1021/acs.jafc.3c01262
16	Zhu Q, Guo R, Liu C, et al. Endoplasmic reticulum stress-mediated apoptosis contributing to high glucose-induced vascular smooth muscle cell calcification[J]. J Vasc Res, 2015, 52(5): 291-8. DOI: 10.1159/000442980
17	Deng BY, Liao F, Liu YH, et al. Comprehensive analysis of endoplasmic reticulum stress-associated genes signature of ulcerative colitis[J]. Front Immunol, 2023, 14: 1158648. DOI: 10.3389/fimmu.2023.1158648
18	Franz M, Rodriguez H, Lopes C, et al. GeneMANIA update 2018[J]. Nucleic Acids Res, 2018, 46(W1): W60-4. DOI: 10.1093/nar/gky311
19	Chen BB, Khodadoust MS, Liu CL, et al. Profiling tumor infiltrating immune cells with CIBERSORT[J]. Methods Mol Biol, 2018, 1711: 243-59. DOI: 10.1007/978-1-4939-7493-1_12
20	Han H, Cho JW, Lee S, et al. TRRUST v2: an expanded reference database of human and mouse transcriptional regulatory interactions[J]. Nucleic Acids Res, 2018, 46(D1): D380-6. DOI: 10.1093/nar/gkx1013
21	Zhou GY, Soufan O, Ewald J, et al. NetworkAnalyst 3.0: a visual analytics platform for comprehensive gene expression profiling and meta-analysis[J]. Nucleic Acids Res, 2019, 47(W1): W234-41. DOI: 10.1093/nar/gkz240
22	Chen HL, Luo SX, Chen HM, et al. ATF3 regulates SPHK1 in cardiomyocyte injury via endoplasmic reticulum stress[J]. Immun Inflamm Dis, 2023, 11(9): e998. DOI: 10.1002/iid3.998
23	Zhou FY, Gao HY, Shang LR, et al. Oridonin promotes endoplasmic reticulum stress via TP53-repressed TCF₄ transactivation in colorectal cancer[J]. J Exp Clin Cancer Res, 2023, 42(1): 150. DOI: 10.1186/s13046-023-02702-4
24	Corica D, Pepe G, Currò M, et al. Methods to investigate advanced glycation end-product and their application in clinical practice[J]. Methods, 2022, 203: 90-102. DOI: 10.1016/j.ymeth.2021.12.008
25	Mishra M, Prasad K. AGE-RAGE stress, stressors, and antistressors in health and disease[J]. Int J Angiol, 2018, 27(1): 1-12. DOI: 10.1055/s-0037-1613678
26	Reddy VP, Aryal P, Darkwah EK. Advanced glycation end products in health and disease[J]. Microorganisms, 2022, 10(9): 1848. DOI: 10.3390/microorganisms10091848
27	Fishman SL, Sonmez H, Basman C, et al. The role of advanced glycation end-products in the development of coronary artery disease in patients with and without diabetes mellitus: a review[J]. Mol Med, 2018, 24(1): 59-66. DOI: 10.1186/s10020-018-0060-3
28	Burr SD, Harmon MB, Jr JAS. The impact of diabetic conditions and AGE/RAGE signaling on cardiac fibroblast migration[J]. Front Cell Dev Biol, 2020, 8: 112-23. DOI: 10.3389/fcell.2020.00112
29	Grond-Ginsbach C, Pjontek R, Aksay SS, et al. Spontaneous arterial dissection: phenotype and molecular pathogenesis[J]. Cell Mol Life Sci, 2010, 67(11): 1799-815. DOI: 10.1007/s00018-010-0276-z
30	Raffort J, Lareyre F, Clément M, et al. Monocytes and macrophages in abdominal aortic aneurysm[J]. Nat Rev Cardiol, 2017, 14: 457-71. DOI: 10.1038/nrcardio.2017.52
31	Golledge J, Karan M, Moran CS, et al. Reduced expansion rate of abdominal aortic aneurysms in patients with diabetes may be related to aberrant monocyte-matrix interactions[J]. Eur Heart J, 2008, 29(5): 665-72. DOI: 10.1093/eurheartj/ehm557
32	Rao ZQ, Zheng YD, Xu L, et al. Endoplasmic reticulum stress and pathogenesis of vascular calcification[J]. Front Cardiovasc Med, 2022, 9: 918056. DOI: 10.3389/fcvm.2022.918056
33	Kurihara T, Shimizu-Hirota R, Shimoda M, et al. Neutrophil-derived matrix metalloproteinase 9 triggers acute aortic dissection[J]. Circulation, 2012, 126(25): 3070-80. DOI: 10.1161/circulationaha.112.097097
34	Tyrrell DJ, Goldstein DR. Ageing and atherosclerosis: vascular intrinsic and extrinsic factors and potential role of IL-6[J]. Nat Rev Cardiol, 2021, 18: 58-68. DOI: 10.1038/s41569-020-0431-7
35	An Z, Qiao F, Lu QJ, et al. Interleukin-6 downregulated vascular smooth muscle cell contractile proteins via ATG4B-mediated autophagy in thoracic aortic dissection[J]. Heart Vessels, 2017, 32(12): 1523-35. DOI: 10.1007/s00380-017-1054-8
36	Xu HJ, Li Y, Wang H, et al. Systemic immune-inflammation index predicted short-term outcomes in ATAD patients undergoing surgery[J]. J Card Surg, 2022, 37(4): 969-75. DOI: 10.1111/jocs.16300
37	Ait-Oufella H, Wang Y, Herbin O, et al. Natural regulatory T cells limit angiotensin II-induced aneurysm formation and rupture in mice[J]. Arterioscler Thromb Vasc Biol, 2013, 33(10): 2374-9. DOI: 10.1161/atvbaha.113.301280
38	Hu XX, Schwarz JK, Lewis JS Jr, et al. A microRNA expression signature for cervical cancer prognosis[J]. Cancer Res, 2010, 70(4): 1441-8. DOI: 10.1158/0008-5472.can-09-3289
39	Xu ZJ, Lang DH, Wang D, et al. LncRNA FGD5-AS1 promotes abdominal aortic aneurysm growth through the activation of MMP3 in vascular smooth muscle cells[J]. Int Heart J, 2023, 64(3): 470-82. DOI: 10.1536/ihj.22-106
40	Wang Y, Zhang cheng-xin, Ge sheng-lin, et al. CTBP1-AS2 inhibits proliferation and inducesautophagy in ox-LDL-stimulated vascular smooth musclecells by regulating miR-195-5p/ATG14[J]. Int J Mol Med, 2020, 46(2): 839-48. DOI: 10.3892/ijmm.2020.4624

[1]	Xinyuan CHEN, Chengting WU, Ruidi LI, Xueqin PAN, Yaodan ZHANG, Junyu TAO, Caizhi LIN. Shuangshu Decoction inhibits growth of gastric cancer cell xenografts by promoting cell ferroptosis via the P53/SLC7A11/GPX4 axis [J]. Journal of Southern Medical University, 2025, 45(7): 1363-1371.
[2]	Kang WANG, Haibin LI, Jing YU, Yuan MENG, Hongli ZHANG. High expression of ELFN1 is a prognostic biomarker and promotes proliferation and metastasis of colorectal cancer cells [J]. Journal of Southern Medical University, 2025, 45(7): 1543-1553.
[3]	Yujia YANG, Lifang YANG, Yaling WU, Zhaoda DUAN, Chunze YU, Chunyun WU, Jianyun YU, Li YANG. Cannabidiol inhibits neuronal endoplasmic reticulum stress and apoptosis in rats with multiple concussions by regulating the PERK-eIF2α-ATF4-CHOP pathway [J]. Journal of Southern Medical University, 2025, 45(6): 1240-1250.
[4]	Zhi GAO, Ao WU, Zhongxiang HU, Peiyang SUN. Bioinformatics analysis of oxidative stress and immune infiltration in rheumatoid arthritis [J]. Journal of Southern Medical University, 2025, 45(4): 862-870.
[5]	Huaiwen XU, Li WENG, Hong XUE. CXCL12 is a potential therapeutic target for type 2 diabetes mellitus complicated by chronic obstructive pulmonary disease [J]. Journal of Southern Medical University, 2025, 45(1): 100-109.
[6]	Mengnan YE, Hongmei WU, Yan MEI, Qingling ZHANG. High expression of CREM is associated with poor prognosis in gastric cancer patients [J]. Journal of Southern Medical University, 2024, 44(9): 1776-1782.
[7]	Kai JI, Guanyu YU, Leqi ZHOU, Tianshuai ZHANG, Qianlong LING, Wenjiang MAN, Bing ZHU, Wei ZHANG. HNRNPA1 gene is highly expressed in colorectal cancer: its prognostic implications and potential as a therapeutic target [J]. Journal of Southern Medical University, 2024, 44(9): 1685-1695.
[8]	Hongli YANG, Yayun XIANG, Tingting TAN, Yang LEI. ORY-1001 inhibits glioblastoma cell growth by downregulating the Notch/HES1 pathway via suppressing lysine-specific demethylase 1 expression [J]. Journal of Southern Medical University, 2024, 44(8): 1620-1630.
[9]	Lingjun LU, Xiaodi YANG, Huaping ZHANG, Yuan LIANG, Xiulan SHI, Xin ZHOU. Recombinant Schistosoma japonicum cystatin alleviates acute liver injury in mice by inhibiting endoplasmic reticulum stress, inflammation and hepatocyte apoptosis [J]. Journal of Southern Medical University, 2024, 44(6): 1126-1134.
[10]	Zhiwei ZUO, Qingliang MENG, Jiakang CUI, Kelei GUO, Hua BIAN. An artificial neural network diagnostic model for scleroderma and immune cell infiltration analysis based on mitochondria-associated genes [J]. Journal of Southern Medical University, 2024, 44(5): 920-929.
[11]	Bei PEI, Yi ZHANG, Siyuan WEI, Yu MEI, Biao SONG, Gang DONG, Ziang WEN, Xuejun LI. Identification of potential pathogenic genes of intestinal metaplasia based on transcriptomic sequencing and bioinformatics analysis [J]. Journal of Southern Medical University, 2024, 44(5): 941-949.
[12]	Qinzhi WANG, Bing SONG, Shirui HAO, Zhiyuan XIAO, Lianhui JIN, Tong ZHENG, Fang CHAI. Bioinformatic analysis of CCND2 expression in papillary thyroid carcinoma and its impact on immune infiltration [J]. Journal of Southern Medical University, 2024, 44(5): 981-988.
[13]	LIANG Yihao, LAI Yingjun, YUAN Yanwen, YUAN Wei, ZHANG Xibo, ZHANG Bashan, LU Zhifeng. Screening of differentially expressed genes in gastric cancer based on GEO database and function and pathway enrichment analysis [J]. Journal of Southern Medical University, 2024, 44(3): 605-616.
[14]	ZHANG Xiaoyan, WANG Xie, WANG Jie, SHAO Nan, CAI Biao, XIE Daojun. Huangpu Tongqiao Capsule improves cognitive impairment in rats with Wilson disease by inhibiting endoplasmic reticulum stress-mediated apoptosis pathway [J]. Journal of Southern Medical University, 2024, 44(3): 447-454.
[15]	Zijing REN, Peiyang ZHOU, Jing TIAN. Plasma long noncoding RNA expression profiles in patients with Parkinson's disease and the role of lnc-CTSD-5:1 in a PD cell model: a ceRNA microarray-based study [J]. Journal of Southern Medical University, 2024, 44(11): 2146-2155.