HNRNPA1 gene is highly expressed in colorectal cancer: its prognostic implications and potential as a therapeutic target

doi:10.12122/j.issn.1673-4254.2024.09.08

Abstract

Abstract:

Objective To investigate the expression level of HNRNP A1 in colorectal cancer (CRC) and its prognostic implications. Methods We investigated HNRNP A1 expression level in CRC using HPA, TIMER, and GEPIA databases and analyzed its association with Ki-67 and VEGFA expressions. Kaplan-Meier Plotter database was used to analyze the correlation of HNRNP A1 mRNA levels with the survival rates of CRC patients. Pathway enrichment analysis was performed for predicting the biological roles of HNRNP A1 in CRC progression. Immunohistochemistry and Western blotting were used to examine the protein levels of HNRNP A1 in CRC versus adjacent tissues, and TIMER was used for assessing its expression in the infiltrating immune cells. In RKO/Caco2 cells, the effects of lentivirus-mediated knockdown of HNRNP A1 on cell proliferation and migration were observed, and the inhibitory effect of VPC-80051 (a HNRNP A1 inhibitor) on cell proliferation was evaluated to assess its potential as a therapeutic agent. Results HNRNP A1 was significantly overexpressed in CRC tissues and correlated with a poor prognosis of the patients. HNRNP A1 expression level was correlated with the infiltrating immune cells in CRC microenvironment and positively correlated with MKI67 and VEGFA expressions in CRC. A high HNRNP A1 expression predicted a in survival and progression-free survival of CRC patients and was involved in multiple biological processes related with CRC progression. In RKO/Caco2 cells, HNRNP A1 knockdown significantly suppressed cell proliferation and migration, and treatment with VPC-80051 also effectively inhibited CRC cell proliferation. Immunohistochemical study demonstrated a close correlation of HNRNP A1 overexpression with tumor stage of CRC. Conclusion HNRNP A1 is overexpressed in CRC tissues to modulate cell proliferation and migration and is correlated with a poorer prognosis. VPC-80051 can effectively inhibit CRC cell proliferation, suggesting the potential of HNRNP A1 as a therapeutic target for CRC.

Key words: colorectal cancer, HNRNP A1, proliferation and metastasis, prognosis, bioinformatics

Kai JI, Guanyu YU, Leqi ZHOU, Tianshuai ZHANG, Qianlong LING, Wenjiang MAN, Bing ZHU, Wei ZHANG. HNRNPA1 gene is highly expressed in colorectal cancer: its prognostic implications and potential as a therapeutic target[J]. Journal of Southern Medical University, 2024, 44(9): 1685-1695.

Figures/Tables 10

Tab.1 Primer sequence for qRT-PCR of HNRNP A1

Gene	Primerse quence (5'-3')
Gene	Forward	Reverse
HNRNP A1	TCAGAGTCTCCTAAAGAGCCC	ACCTTGTGTGGCCTTGCAT
GAPDH	ACAACTTTGGTATCGTGGAAGG	GCCATCACGCCACAGTTTC

Fig.1 Expression of HNRNP family members in colorectal cancer and their association with the patients' prognosis. A: Expression of HNRNP family members in colorectal cancer. B-L: Prognostic profile of HNRNP family members in colorectal cancer.

Fig.2 Localization of HNRNPA1 in the cell model and human cells. A: Expression of HNRNP A1 in the cell model. B: Expression of HNRNPA1 in human cells detected using immunofluorescence assay.

Fig.3 Expression of HNRNP A1 in different tissues and immune cells. A: Expression of HNRNP A1 in different tissues. B: Expression of HNRNP A1 in immune cells. C: Expression of HNRNP A1 in the core cells.

Fig. 4 Expression of HNRNP A1 in colorectal cancer and adjacent tissues. A: Expression of HNRNP A1 in different tumors in TIMER 2.0 database. B: Expression of HNRNP A1 in colorectal cancer in GEPIA database. C: Immunohistochemical analysis of SPHK1 expression in colorectal cancer tissue and adjacent tissue.

Fig.5 Correlation of HNRNP A1 with MKI67 and VEGFA expressions and prognosis of colorectal cancer patients. A: Correlation between HNRNP A1 and MKI67 expression. B: Correlation between HNRNP A1 and VEGFA expression. C: Expression of MKI67 in CRC tissue. D: Expression of VEGFA in colorectal cancer tissue. E: Expression of HNRNPA1 in COAD based on individual cancer stages. F: Expression of HNRNPA1 in READ based on individual cancer stages. G: Overall survival of colorectal cancer patients. H: Post progression survival in colorectal cancer patients.

Fig.6 Correlation between HNRNP A1 and immune infiltration level in colorectal cancer. A: Expression of HNRNP A1 correlates with immune cell infiltration in colon cancer microenvironment. B: Expression of HNRNP A1 correlates with immune cell infiltration in rectal cancer microenvironment.

Fig.7 Enrichment analysis of HNRNP A1 pathways. A: GOterm analysis of BP. B: GOterm analysis of CC. C: GOterm analysis of MF. D: KEGGterm analysis result.

Fig.8 HNRNP A1 promotes proliferation and migration of colorectal cancer cells. A, B, G, H: Relative expression level of HNRNPA1 in RKO cells. C, I: CCK-8 assay for assessing cell proliferation. D, J: Clone formation assay. E, K: Wound-healing assay for assessing cell migration (Scale bar: 200 μm). F, L: Transwell assay for assessing cell migration (Scale bar: 50 μm). M, N: Effect of VPC-80051 at different concentrations on cell proliferation. O: Viability of the cells treated with 10 μmol/L VPC-80051 at different time points. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001

Tab.2 Relationship between HNRNP A1 expression and clinical characteristics of the patients

Parameters	Clinical case characteristics
Parameters	Case	Rate (%)
Gender
Male	29	59.2
Female	20	40.8
Age (year)
≥60	32	65.3
<60	17	34.7
Pathologic stage
Tis	2	4.08
Ⅰ+Ⅱ	25	51.02
Ⅲ+Ⅳ	22	44.9
T stage
T1+T2	14	29.79
T3+T4	33	70.21
N stage
N0	25	53.19
N1+N2	22	46.81

References 34

1	Xi Y, Xu PF. Global colorectal cancer burden in 2020 and projections to 2040[J]. Transl Oncol, 2021, 14(10): 101174.
2	Ahmad R, Singh JK, Wunnava A, et al. Emerging trends in colorectal cancer: Dysregulated signaling pathways (Review)[J]. Int J Mol Med, 2021, 47(3): 14.
3	Klimeck L, Heisser T, Hoffmeister M, et al. Colorectal cancer: a health and economic problem[J]. Best Pract Res Clin Gastroenterol, 2023, 66: 101839.
4	Li QY, Zhao HX, Dong WW, et al. RAB27A promotes the proliferation and invasion of colorectal cancer cells[J]. Sci Rep, 2022, 12(1): 19359.
5	Siculella L, Giannotti L, Di Chiara Stanca B, et al. A comprehensive understanding of hnRNP A1 role in cancer: new perspectives on binding with noncoding RNA[J]. Cancer Gene Ther, 2023, 30(3): 394-403.
6	杨宏广, 童春梅, 邓惠敏. hnRNP A1的功能研究进展[J]. 生物化学与生物物理进展, 2021, 48(10): 1146-56.
7	Liu X, Ishizuka T, Bao HL, et al. Structure-dependent binding of hnRNPA1 to telomere RNA[J]. J Am Chem Soc, 2017, 139(22): 7533-9.
8	Li YX, Yang Y, Ma Q, et al. HNRNPK/CLCN3 axis facilitates the progression of LUAD through CAF-tumor interaction[J]. Int J Biol Sci, 2022, 18(16): 6084-101.
9	Li MY, Yang XJ, Zhang GX, et al. Heterogeneous nuclear ribonucleoprotein K promotes the progression of lung cancer by inhibiting the p53-dependent signaling pathway[J]. Thorac Cancer, 2022, 13(9): 1311-21.
10	Jiang RQ, Su GF, Chen X, et al. Esculetin inhibits endometrial cancer proliferation and promotes apoptosis via hnRNPA1 to down-regulate BCLXL and XIAP[J]. Cancer Lett, 2021, 521: 308-21.
11	Xu HR, Li P, Wang XY, et al. Emerging roles of hnRNP A2B1 in cancer and inflammation[J]. Int J Biol Macromol, 2022, 221: 1077-92.
12	Möller K, Wecker AL, Höflmayer D, et al. Upregulation of the heterogeneous nuclear ribonucleoprotein hnRNPA1 is an independent predictor of early biochemical recurrence in TMPRSS2: ERG fusion-negative prostate cancers[J]. Virchows Arch, 2020, 477(5): 625-36.
13	Ma YL, Peng JY, Zhang P, et al. Heterogeneous nuclear ribonucleoprotein A1 is identified as a potential biomarker for colorectal cancer based on differential proteomics technology[J]. J Proteome Res, 2009, 8(10): 4525-35.
14	Ghosh M, Singh M. RGG-box in hnRNPA1 specifically recognizes the telomere G-quadruplex DNA and enhances the G-quadruplex unfolding ability of UP1 domain[J]. Nucleic Acids Res, 2018, 46(19): 10246-61.
15	Biller LH, Schrag D. Diagnosis and treatment of metastatic colorectal cancer: a review[J]. JAMA, 2021, 325(7): 669-85.
16	Liu Y, Shi SL. The roles of hnRNP A2/B1 in RNA biology and disease[J]. Wiley Interdiscip Rev RNA, 2021, 12(2): e1612.
17	Xie W, Zhu HC, Zhao M, et al. Crucial roles of different RNA-binding hnRNP proteins in Stem Cells[J]. Int J Biol Sci, 2021, 17(3): 807-17.
18	Dutta K, Kravtsov V, Oleynikova K, et al. Analyzing the effects of single nucleotide polymorphisms on hnRNPA2/B1 protein stability and function: insights for anticancer therapeutic design[J]. ACS Omega, 2024, 9(5): 5485-95.
19	Low YH, Asi Y, Foti SC, et al. Heterogeneous nuclear ribonucleoproteins: implications in neurological diseases[J]. Mol Neurobiol, 2021, 58(2): 631-46.
20	Kim HJ, Kim NC, Wang YD, et al. Mutations in prion-like domains in hnRNPA2B1 and hnRNPA1 cause multisystem proteinopathy and ALS[J]. Nature, 2013, 495(7442): 467-73.
21	Xia AL, Yuan WW, Wang Q, et al. The cancer-testis lncRNA lnc-CTHCC promotes hepatocellular carcinogenesis by binding hnRNP K and activating YAP1 transcription[J]. Nat Cancer, 2022, 3(2): 203-18.
22	Gao R, Yu Y, Inoue A, et al. Heterogeneous nuclear ribonucleoprotein K (hnRNP-K) promotes tumor metastasis by induction of genes involved in extracellular matrix, cell movement, and angiogenesis[J]. J Biol Chem, 2013, 288(21): 15046-56.
23	Zhu HE, Li T, Shi SN, et al. ESCO₂ promotes lung adenocarcinoma progression by regulating hnRNPA1 acetylation[J]. J Exp Clin Cancer Res, 2021, 40(1): 64.
24	Zhou JM, Jiang H, Yuan T, et al. High hnRNP AB expression is associated with poor prognosis in patients with colorectal cancer[J]. Oncol Lett, 2019, 18(6): 6459-68.
25	Li H, Liu JW, Shen SX, et al. Pan-cancer analysis of alternative splicing regulator heterogeneous nuclear ribonucleoproteins (hnRNPs) family and their prognostic potential[J]. J Cell Mol Med, 2020, 24(19): 11111-9.
26	Shi X, Ran L, Liu Y, et al. Knockdown of hnRNP A2/B1 inhibits cell proliferation, invasion and cell cycle triggering apoptosis in cervical cancer via PI3K/AKT signaling pathway[J]. Oncol Rep, 2018, 39(3): 939-50.
27	Zhang PS, Ji DH, Hu XH, et al. Oncogenic heterogeneous nuclear ribonucleoprotein D-like promotes the growth of human colon cancer SW620 cells via its regulation of cell-cycle[J]. Acta Biochim Biophys Sin, 2018, 50(9): 880-7.
28	Yao P, Wu JB, Lindner D, et al. Interplay between miR-574-3p and hnRNP L regulates VEGFA mRNA translation and tumorigenesis[J]. Nucleic Acids Res, 2017, 45(13): 7950-64.
29	Bilotta MT, Antignani A, Fitzgerald DJ. Managing the TME to improve the efficacy of cancer therapy[J]. Front Immunol, 2022, 13: 954992.
30	Khan S, Kwak YT, Peng L, et al. NLRP12 downregulates the Wnt/β-catenin pathway via interaction with STK38 to suppress colorectal cancer[J]. J Clin Invest, 2023, 133(19): e166295.
31	Bradley RK, Anczuków O. RNA splicing dysregulation and the hallmarks of cancer[J]. Nat Rev Cancer, 2023, 23(3): 135-55.
32	Wan LD, Yu WY, Shen EH, et al. SRSF6-regulated alternative splicing that promotes tumour progression offers a therapy target for colorectal cancer[J]. Gut, 2019, 68(1): 118-29.
33	Wen ZL, Lian LY, Ding H, et al. LncRNA ANCR promotes hepatocellular carcinoma metastasis through upregulating HNRNPA1 expression[J]. RNA Biol, 2020, 17(3): 381-94.
34	Carabet LA, Leblanc E, Lallous N, et al. Computer-aided discovery of small molecules targeting the RNA splicing activity of hnRNP A1 in castration-resistant prostate cancer[J]. Molecules, 2019, 24(4): 763.

[1]	Xiaohua CHEN, Hui LU, Ziliang WANG, Lian WANG, Yongsheng XIA, Zhijun GENG, Xiaofeng ZHANG, Xue SONG, Yueyue WANG, Jing LI, Jianguo HU, Lugen ZUO. Role of Abelson interactor 2 in progression and prognosis of gastric cancer and its regulatory mechanisms [J]. Journal of Southern Medical University, 2024, 44(9): 1653-1661.
[2]	Mengnan YE, Hongmei WU, Yan MEI, Qingling ZHANG. High expression of CREM is associated with poor prognosis in gastric cancer patients [J]. Journal of Southern Medical University, 2024, 44(9): 1776-1782.
[3]	Yinliang ZHANG, Zetan LUO, Rui ZHAO, Na ZHAO, Zhidong XU, Di AO, Guyi CONG, Xinyu LIU, Hailun ZHENG. Sanguinarine induces ferroptosis of colorectal cancer cells by upregulating STUB1 and downregulating GPX4 [J]. Journal of Southern Medical University, 2024, 44(8): 1537-1544.
[4]	Hongli YANG, Yayun XIANG, Tingting TAN, Yang LEI. ORY-1001 inhibits glioblastoma cell growth by downregulating the Notch/HES1 pathway via suppressing lysine-specific demethylase 1 expression [J]. Journal of Southern Medical University, 2024, 44(8): 1620-1630.
[5]	Heping LI, Gaohua LI, Xuehua ZHANG, Yanan WANG. Genetic drivers for inflammatory protein markers in colorectal cancer: a Mendelian randomization approach to clinical prognosis study [J]. Journal of Southern Medical University, 2024, 44(7): 1361-1370.
[6]	Wei ZHOU, Jun NIE, Jia HU, Yizhi JIANG, Dafa ZHANG. Differential expressions of endoplasmic reticulum stress-associated genes in aortic dissection and their correlation with immune cell infiltration [J]. Journal of Southern Medical University, 2024, 44(5): 859-866.
[7]	Nan WANG, Bin SHI, Xiaolan MAN, Weichao WU, Jia CAO. High expression of fragile X mental retardation protein inhibits ferroptosis of colorectal tumor cells by activating the RAS/MAPK signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 885-893.
[8]	Bei PEI, Yi ZHANG, Siyuan WEI, Yu MEI, Biao SONG, Gang DONG, Ziang WEN, Xuejun LI. Identification of potential pathogenic genes of intestinal metaplasia based on transcriptomic sequencing and bioinformatics analysis [J]. Journal of Southern Medical University, 2024, 44(5): 941-949.
[9]	Jingjing YANG, Lixia YIN, Ting DUAN, Minzhu NIU, Zhendong HE, Xinrui CHEN, Xiaofeng ZHANG, Jing LI, Zhijun GENG, Lugen ZUO. High expression of ATP5A1 in gastric carcinoma is correlated with a poor prognosis and enhanced glucose metabolism in tumor cells [J]. Journal of Southern Medical University, 2024, 44(5): 974-980.
[10]	Qinzhi WANG, Bing SONG, Shirui HAO, Zhiyuan XIAO, Lianhui JIN, Tong ZHENG, Fang CHAI. Bioinformatic analysis of CCND2 expression in papillary thyroid carcinoma and its impact on immune infiltration [J]. Journal of Southern Medical University, 2024, 44(5): 981-988.
[11]	LIANG Yihao, LAI Yingjun, YUAN Yanwen, YUAN Wei, ZHANG Xibo, ZHANG Bashan, LU Zhifeng. Screening of differentially expressed genes in gastric cancer based on GEO database and function and pathway enrichment analysis [J]. Journal of Southern Medical University, 2024, 44(3): 605-616.
[12]	SHEN Mengdi, ZHAO Na, DENG Xiaojing, DENG Min. High expression of COX6B2 in gastric cancer is associated with poor long-term prognosis and promotes cell proliferation and cell cycle progression by inhibiting p53 signaling [J]. Journal of Southern Medical University, 2024, 44(2): 289-297.
[13]	ZHANG Nuo, ZHANG Zhen, ZHANG Yulu, SONG Xue, ZHANG Xiaofeng, LI Jing, ZUO Lugen, HU Jianguo. PCID2 is highly expressed in gastric cancer and affects the prognosis by regulating cancer cell cycle and proliferation [J]. Journal of Southern Medical University, 2024, 44(2): 324-332.
[14]	ZHANG Wenjing, ZHANG Nuo, YANG Zi, ZHANG Xiaofeng, SUN Aofei, WANG Lian, SONG Xue, GENG Zhijun, LI Jing, HU Jianguo. Overexpression of BZW1 promotes invasion and metastasis of gastric cancer cells by regulating Wnt/β-catenin signaling and promoting epithelial-mesenchymal transition [J]. Journal of Southern Medical University, 2024, 44(2): 354-362.
[15]	CHENG Jiacong, LI Zhihui, LIU Yao, LI Cheng, HUANG Xin, TIAN Yinxin, SHEN Fubing. Bioinformatics analysis and validation of the interaction between PML protein and TAB1 protein [J]. Journal of Southern Medical University, 2024, 44(1): 179-186.