Sphingomyelin phosphodiesterase 1 knockdown promotes exogenous dihomo-γ-linolenic acid-induced ferroptosis in acute myeloid leukemia cells

doi:10.12122/j.issn.1673-4254.2026.10.12

Abstract

Abstract:

Objective To identify the potential target genes involved in the regulation of dihomo‑γ‑linolenic acid (DGLA)-induced ferroptosis in acute myeloid leukemia (AML) cells and to investigate their functional role in this process.. Methods BALB/c nude mouse models bearing subcutaneous THP-1 cell xenografts were treated with DGLA or an equal volume of vehicle by gavage (n=6). Tumor growth was monitored, and ferroptosis-related markers in the xenografts were detected. RNA-seq combined with FerrDb analysis was used to identify a target gene involved in DGLA-induced ferroptosis in AML cells, followed by qRT-PCR validation. A target gene-knockdown AML cell line was established to evaluate the effects of knockdown combined with DGLA treatment on AML cell phenotypes and ferroptosis in vitro and in vivo. Results In the tumor-bearing mice, DGLA treatment markedly reduced the tumor volume and weight, and the tumor cells showed typical ultrastructural changes of ferroptosis with upregulated levels of ROS, MDA, and Fe²⁺ and increased mRNA and protein expression levels of TfR1 and PTGS2. RNA-seq combined with the FerrDb database analysis revealed significant upregulation of SMPD1 in AML cells with DGLA-induced ferroptosis. In THP-1 cells with SMPD1 knockdown, DGLA treatment significantly reduced the cell viability, aggravated mitochondrial ferroptotic injury, and increased intracellular ROS, MDA and Fe²⁺ levels, causing also significant reductions of protein levels of GPX4 and SLC7A11. In the mouse models bearing xenografts derived from THP-1 cells with SMPD1 knockdown, DGLA treatment significantly decreased tumor volume and weight and increased the expressions of the lipid peroxidation markers (MDA, ROS, and Fe²⁺) and the protein levels of TfR1 and PTGS2. Conclusion SMPD1 knockdown enhances DGLA-induced ferroptosis and represses cell viability in AML cells both in vitro and in vivo.

Key words: dihomo?γ?linolenic acid, ferroptosis, polyunsaturated fatty acid, sphingomyelin phosphodiesterase 1, acute myeloid leukemia

Yingying HUANG, Wei WU, Xiaoying HONG, Xiandong JIANG, Yan XUE, Donghong LIN. Sphingomyelin phosphodiesterase 1 knockdown promotes exogenous dihomo-γ-linolenic acid-induced ferroptosis in acute myeloid leukemia cells[J]. Journal of Southern Medical University, 2026, 46(10): 2424-2433.

Figures/Tables 7

Tab.1 Primer sequences

Primer name	Sequences(5'-3')
β-actin-F	TGACGTGGACATCCGCAAAG
β-actin-R	CTGGAAGGTGGACAGCGAGG
TfR1-F	GGCTACTTGGGCTATTGTAAAGG
TfR1-R	CAGTTTCTCCGACAACTTTCTCT
PTGS2-F	CTGGCGCTCAGCCATACAG
PTGS2-R	CGCACTTATACTGGTCAAATCCC
SMPD1-F	CAGGTATGAGAACACCCTGGC
SMPD1-R	CCGATGTAGGTAGTTGCACTG

Fig.1 Establishment of nude mouse models bearing subcutaneous AML cell xenograft. A: Mouse grouping of subcutaneous xenograft model. B: Dissected tumors from DGLA and vehicle groups. C: Tumor volume in DGLA and vehicle groups. D: Tumor weight changes in DGLA and vehicle groups. **P<0.01, ***P<0.001 vs vehicle group, n=6.

Fig.2 Detection of ferroptosis markers in subcutaneous xenografts derived from DGLA-induced AML cells. A: Flow histogram of lipid ROS levels. B: Quantitative result of ROS. C: Detection of MDA levels. D: Detection of Fe2+ levels. E: Changes of mitochondrial ultrastructural (Scale bar=1 μm). White arrows: normal mitochondria; red arrows: ferroptotic mitochondria; yellow arrows: lipid droplets. F, G: TfR1 and PTGS2 mRNA expression levels. H: TfR1 and PTGS2 protein blotting bands. I, J: TfR1 and PTGS2 protein expression levels. *P<0.05, **P<0.01, ***P<0.001 vs Vehicle group (n=6); n=3 for qRT-PCR and Western blotting analysis.

Fig.3 Significant upregulation of SMPD1 identified by RNA-seq combined with FerrDb analysis. A: PCA plot of RNA-seq. B: Bar chart of differentially expressed genes. C: Bubble chart depicting the KEGG enrichment of the differentially expressed genes. D: Heatmap of lipid metabolism. E: Venn diagram of lipid metabolism and FerrDb. F: Changes of SMPD1 mRNA level after DGLA treatment. **P<0.01 vs vehicle group (n=3).

Fig.4 Downregulation of SMPD1 enhances DGLA-induced inhibition of AML cell viability in vitro. A, B: SMPD1 expression levels in THP-1 cells after lentiviral transfection. C: Effect of SMPD1 knockdown on THP-1 cell viability with DGLA treatment. **P<0.01 vs NC group, #P<0.001. n=3.

Fig.5 SMPD1 knockdown promotes DGLA-induced ferroptosis in AML cells in vitro. A-D: Effect of SMPD1 knockdown on ROS, MDA and Fe2+ in THP-1 cells with DGLA treatment. E: Effect of SMPD1 knockdown on mitochondrial ultrastructure of THP-1 with DGLA treatment (Scale bar=1 μm). White arrows: normal mitochondria; red arrows: Ferroptotic mitochondria; yellow arrows: Lipid droplets. F-H: SLC7A11 and GPX4 protein expression levels. *P<0.05, **P<0.01, ***P<0.001 vs NC+DGLA group (n=3).

Fig.6 SMPD1 knockdown promotes DGLA-induced ferroptosis of AML cells in mice. A: Observation of subcutaneous AML tumors in the mice. B: Dissected of subcutaneous tumors from each group. C: Tumor volume. D: Tumor weight. E: Mitochondrial ultrastructure in subcutaneous tumors from each group (Scale bar=1 μm). White arrows: Normal mitochondria; red arrows: Ferroptotic mitochondria; yellow arrows: Lipid droplets. F-I: ROS, MDA and Fe2+ levels. J-M: SMPD1, TfR1 and PTGS2 protein expression levels. *P<0.05, **P<0.01, ***P<0.001 vs NC+DGLA group. #P<0.05 vs NC+Vehicle group (n=6); n=3 per group for Western blotting analysis.

References 37

[1]	Zhang SJ, Liu MH, Yao YF, et al. Targeting LSD1 for acute myeloid leukemia (AML) treatment[J]. Pharmacol Res, 2021, 164: 105335. doi：10.1016/j.phrs.2020.105335
[2]	Haubner S, Subklewe M, Sadelain M. Honing CAR T cells to tackle acute myeloid leukemia[J]. Blood, 2025, 145(11): 1113-25. doi：10.1182/blood.2024024063
[3]	Feng J, Li YL, He F, et al. RBM15 silencing promotes ferroptosis by regulating the TGF‑β/Smad2 pathway in lung cancer[J]. Environ Toxicol, 2023, 38(4): 950-61. doi：10.1002/tox.23741
[4]	Yang C, Lu T, Liu M, et al. Tiliroside targets TBK1 to induce ferroptosis and sensitize hepatocellular carcinoma to sorafenib[J]. Phytomedicine, 2023, 111: 154668. doi：10.1016/j.phymed.2023.154668
[5]	Yang F, Xiao Y, Ding JH, et al. Ferroptosis heterogeneity in triple-negative breast cancer reveals an innovative immunotherapy combination strategy[J]. Cell Metab, 2023, 35(1): 84-100.e8. doi：10.1016/j.cmet.2022.09.021
[6]	Yang WS, SriRamaratnam R, Welsch ME, et al. Regulation of ferroptotic cancer cell death by GPX4[J]. Cell, 2014, 156(1/2): 317-31. doi：10.1016/j.cell.2013.12.010
[7]	Dixon SJ, Lemberg KM, Lamprecht MR, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death[J]. Cell, 2012, 149(5): 1060-72. doi：10.1016/j.cell.2012.03.042
[8]	Tousignant KD, Rockstroh A, Poad BLJ, et al. Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancer[J]. Cancer Metab, 2020, 8(1): 11. doi：10.1186/s40170-020-00217-6
[9]	Han JW, Zheng DH, Liu PS, et al. Peroxisomal homeostasis in metabolic diseases and its implication in ferroptosis[J]. Cell Commun Signal, 2024, 22(1): 475. doi：10.1186/s12964-024-01862-w
[10]	Turchi R, Tortolici F, Benvenuto M, et al. Low sulfur amino acid, high polyunsaturated fatty acid diet inhibits breast cancer growth[J]. Int J Mol Sci, 2022, 24(1): 249. doi：10.3390/ijms24010249
[11]	Habib A, Mynott RL, Best OG, et al. Novel (1S, 3R)‑RSL3-encapsulated polyunsaturated fatty acid rich liposomes sensitise multiple myeloma cells to ferroptosis-mediated cell death[J]. Int J Mol Sci, 2025, 26(14): 6579. doi：10.3390/ijms26146579
[12]	Nilsen DWT, Myhre PL, Kalstad A, et al. Serum levels of dihomo-gamma (γ)-linolenic acid (DGLA) are inversely associated with linoleic acid and total death in elderly patients with a recent myocardial infarction[J]. Nutrients, 2021, 13(10): 3475. doi：10.3390/nu13103475
[13]	Perez MA, Magtanong L, Dixon SJ, et al. Dietary lipids induce ferroptosis in caenorhabditiselegans and human cancer cells[J]. Dev Cell, 2020, 54(4): 447-54.e4. doi：10.1016/j.devcel.2020.06.019
[14]	Sarparast M, Pourmand E, Hinman J, et al. Dihydroxy-metabolites of dihomo‑γ‑linolenic acid drive ferroptosis-mediated neuro-degeneration[J]. ACS Cent Sci, 2023, 9(5): 870-82. doi：10.1021/acscentsci.3c00052
[15]	Jiang XD, Huang YY, Hong XY, et al. Exogenous dihomo‑γ-linolenic acid triggers ferroptosis via ACSL4-mediated lipid metabolic reprogramming in acute myeloid leukemia cells[J]. Transl Oncol, 2025, 52: 102227. doi：10.1016/j.tranon.2024.102227
[16]	Döhner H, Wei AH, Appelbaum FR, et al. Diagnosis and management of AML in adults: 2022 recommendations from an international expert panel on behalf of the ELN[J]. Blood, 2022, 140(12): 1345-77. doi：10.1182/blood.2022016867
[17]	Kantarjian H, Kadia T, DiNardo C, et al. Acute myeloid leukemia: current progress and future directions[J]. Blood Cancer J, 2021, 11(2): 41. doi：10.1038/s41408-021-00425-3
[18]	Kremer DM, Nelson BS, Lin L, et al. GOT1 inhibition promotes pancreatic cancer cell death by ferroptosis[J]. Nat Commun, 2021, 12(1): 4860. doi：10.1038/s41467-021-24859-2
[19]	Yang JJ, Zhou YL, Xie SD, et al. Metformin induces Ferroptosis by inhibiting UFMylation of SLC7A11 in breast cancer[J]. J Exp Clin Cancer Res, 2021, 40(1): 206. doi：10.1186/s13046-021-02012-7
[20]	Peng YX, Li N, Tang FF, et al. Corosolic acid sensitizes ferroptosis by upregulating HERPUD1 in liver cancer cells[J]. Cell Death Discov, 2022, 8(1): 376. doi：10.1038/s41420-022-01169-0
[21]	Mustonen AM, Nieminen P. Dihomo‑γ-linolenic acid (20: 3n-6)-metabolism, derivatives, and potential significance in chronic inflammation[J]. Int J Mol Sci, 2023, 24(3): 2116. doi：10.3390/ijms24032116
[22]	Stockwell BR, Jiang XJ, Gu W. Emerging mechanisms and disease relevance of ferroptosis[J]. Trends Cell Biol, 2020, 30(6): 478-90. doi：10.1016/j.tcb.2020.02.009
[23]	Zhou N, Yuan XQ, Du QS, et al. FerrDb V2: update of the manually curated database of ferroptosis regulators and ferroptosis-disease associations[J]. Nucleic Acids Res, 2023, 51(D1): D571-82. doi：10.1093/nar/gkac935
[24]	Huang ZW, Li M, Gu BY, et al. Ferroptosis-related LINC02535/has-miR-30c-5p/EIF₂S1 axis as a novel prognostic biomarker involved in immune infiltration and progression of PDAC[J]. Cell Signal, 2024, 123: 111338. doi：10.1016/j.cellsig.2024.111338
[25]	Yang ZW, Han TX, Yang RB, et al. Dicoumarol sensitizes hepatocellular carcinoma cells to ferroptosis induced by imidazole ketone erastin[J]. Front Immunol, 2025, 16: 1531874. doi：10.3389/fimmu.2025.1531874
[26]	Qin JK, Li ZD, Su LZ, et al. Expression of transferrin receptor/TFRC protein in bladder cancer cell T24 and its role in inducing iron death in bladder cancer[J]. Int J Biol Macromol, 2024, 274(Pt 1): 133323. doi：10.1016/j.ijbiomac.2024.133323
[27]	Ma HD, Wang XD, Zhang WL, et al. Melatonin suppresses ferroptosis induced by high glucose via activation of the Nrf2/HO-1 signaling pathway in type 2 diabetic osteoporosis[J]. Oxid Med Cell Longev, 2020, 2020(1): 9067610. doi：10.1155/2020/9067610
[28]	Chen X, Tsvetkov AS, Shen HM, et al. International consensus guidelines for the definition, detection, and interpretation of autophagy-dependent ferroptosis[J]. Autophagy, 2024, 20(6): 1213-46. doi：10.1080/15548627.2024.2319901
[29]	Ye Z, Xie B, Tao YG, et al. Mechanism of ferroptosis and its role in disease development[J]. Int J Biol Sci, 2025, 21(12): 5328-60. doi：10.7150/ijbs.102859
[30]	Feng HZ, Schorpp K, Jin J, et al. Transferrin receptor is a specific ferroptosis marker[J]. Cell Rep, 2020, 30(10): 3411-23.e7. doi：10.1016/j.celrep.2020.02.049
[31]	Kong ZY, Liu R, Cheng YR. Artesunate alleviates liver fibrosis by regulating ferroptosis signaling pathway[J]. Biomed Pharmacother, 2019, 109: 2043-53. doi：10.1016/j.biopha.2018.11.030
[32]	Luo SM, Luo Y, Wang ZM, et al. Super-enhancer mediated upregulation of MYEOV suppresses ferroptosis in lung adenocarcinoma[J]. Cancer Lett, 2024, 589: 216811. doi：10.1016/j.canlet.2024.216811
[33]	Dixon SJ, Pratt DA. Ferroptosis: a flexible constellation of related biochemical mechanisms[J]. Mol Cell, 2023, 83(7): 1030-42. doi：10.1016/j.molcel.2023.03.005
[34]	Aldrovandi M, Fedorova M, Conrad M. Juggling with lipids, a game of Russian roulette[J]. Trends Endocrinol Metab, 2021, 32(7): 463-73. doi：10.1016/j.tem.2021.04.012
[35]	Thayyullathil F, Cheratta AR, Alakkal A, et al. Acid sphingomyelinase-dependent autophagic degradation of GPX4 is critical for the execution of ferroptosis[J]. Cell Death Dis, 2021, 12: 26. doi：10.1038/s41419-020-03297-w
[36]	Guo C, Liao KQ, Chen GL, et al. SMPD1 modulates malignant progress of osteosarcoma through ferroptosis pathway[J]. Tissue Cell, 2026, 102: 103588. doi：10.1016/j.tice.2026.103588
[37]	Sokol KH, Lee CJ, Rogers TJ, et al. Lipid availability influences ferroptosis sensitivity in cancer cells by regulating polyunsaturated fatty acid trafficking[J]. Cell Chem Biol, 2025, 32(3): 408-22.e6. doi：10.1016/j.chembiol.2024.09.008