Diagnostic and predictive value of ferroptosis-related genes in patients with ulcerative colitis

doi:10.12122/j.issn.1673-4254.2025.09.12

Abstract

Abstract:

Objective To explore the value of ferroptose-related genes in the diagnosis and prediction of ulcerative colitis (UC). Methods We used UC dataset from the GEO database to screen for differentially expressed genes (DEGs) in UC. The DEGs related to ferroptositis were screened from the FerrDb database and their functions were analyzed. The hub genes were identified by constructing the protein-protein interaction network (PPI), the differences in immune infiltration levels between UC and the control group were evaluated using CIBERSORT, and the diagnostic values of the hub genes for UC were verified by using the training set. In a mouse model of UC, we examined the expression levels of the hub genes in the colon tissues of the mice using real-time fluorescence quantitative PCR (qPCR). Results We identified a total of 76 DEGs related to ferroptosis. Functional enrichment analysis showed that these genes were significantly enriched in ferroptosis and hypoxia pathways. The PPI network identified 10 hub genes, and 9 of them were highly expressed in UC. Analysis of immune cell infiltration showed that 27 cell types were significantly increased in UC (P<0.05), and the immune checkpoints-related genes had the strongest correlation with the hub gene PPARG (P<0.05). Verification analysis using the training set showed that P4HB, PPARG and STAT3 had the best predictive value for UC (P<0.05). In the UC mouse model, the expression of PPARG was significantly decreased and the expressions of P4HB and STAT3 were significantly increased in the colon tissues of the mice as compared with the normal mice. Conclusion Ferroptose-related genes have significant value for diagnosis and prediction of UC.

Key words: ulcerative colitis, ferroptosis, immune infiltration, PPARG, T cells

Rongmao HE, Zeyang FANG, Yunyun ZHANG, Youliang WU, Shixiu LIANG, Tao JI, Kequan CHEN, Siqi WANG. Diagnostic and predictive value of ferroptosis-related genes in patients with ulcerative colitis[J]. Journal of Southern Medical University, 2025, 45(9): 1927-1937.

Figures/Tables 10

Tab.1 Primers sequences for qPCR

Primer	Sequence
GPX4-F	GATGGAGCCCATTCCTGAACC
GPX4-R	CCCTGTACTTATCCAGGCAGA
NOX1-F	GGTTGGGGCTGAACATTTTTC
NOX1-R	TCGACACACAGGAATCAGGAT
CYBB-F	TGTGGTTGGGGCTGAATGTC
CYBB-R	CTGAGAAAGGAGAGCAGATTTCG
PTGS2-F	TTCAACACACTCTATCACTGGC
PTGS2-R	AGAAGCGTTTGCGGTACTCAT
HIF-1A-F	ACCTTCATCGGAAACTCCAAAG
HIF-1A-R	CTGTTAGGCTGGGAAAAGTTAGG
ACSL1-F	TGCCAGAGCTGATTGACATTC
ACSL1-R	GGCATACCAGAAGGTGGTGAG
SMAD7-F	GGCCGGATCTCAGGCATTC
SMAD7-R	TTGGGTATCTGGAGTAAGGAGG
CD44-F	TCGATTTGAATGTAACCTGCCG
CD44-R	CAGTCCGGGAGATACTGTAGC
PPARG-F	GGAAGACCACTCGCATTCCTT
PPARG-R	GTAATCAGCAACCATTGGGTCA

Fig.1 Differentially expressed genes (DEGs) associated with iron death in UC patients and control subjects. A: Volcano maps of differential gene expressions in UC and control groups. B: Intersection of the DEGs and the genes associated with ferroptosis in UC and control groups. C: Heat maps of the DEGs associated with ferroptosis in UC and control groups. D: Classification of the 76 DEGs associated with ferroptosis, including 41 driver genes, 38 suppressor genes, and 2 marker genes.

Fig.2 Analysis of DEGs enrichment in relation to ferroptosis in UC and control groups. A: KEGG path in UC and control groups. B: Main biological processes of the DEGs in UC patients and control group. C: Main cell components of the DEGs in UC patients and control group. D: Main molecular functions of the DEGs in UC patients and control group.

Fig.3 PPI analysis of the DEGs associated with ferroptosis in UC and controls. A: PPI network of the DEGs associated with ferroptosis in UC and controls. B: MCC algorithm for screening the main hub gene network.

Fig.4 Analysis of the differences in immune checkpoint and immune infiltration between UC and control groups in the dataset. A: Differential expression of 8 immune checkpoint genes between UC and control group. **P<0.01,***P<0.001, ****P<0.0001 (Control group vs UC group). B: Differences in 28 different types of immune cells between UC patients and controls.

Fig.5 Relationship between pivot genes, immune checkpoint genes and immune cells. A: Pearson correlation analysis of the correlations of the hub gene with immune checkpoint gene in UC and control groups. B: CIBERSORT algorithm for assessing the correlation between the key genes and 28 immune cell types in UC and control group. *P<0.05, **P<0.01, ***P<0.001.

Fig.6 Analysis of the diagnostic values of the hub genes for UC using the training set. A: Expression differences of 10 hub genes between UC group and control group. ****P<0.0001, Control group vs UC group. B: ROC curves of the 10 hub genes for UC diagnosis.

Fig.7 Verification of the value of the 10 hub genes for predicting UC. A: Differences in the expression of 10 hub genes between UC group and control group. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 (Control group vs UC group). B: ROC curve of the 10 hub genes for predicting UC.

Fig.8 Hub gene expressions in the colon tissues of the UC mouse model. A: Comparison of disease activity index (DAI) between control and UC mice. B: HE staining of the colon tissue in control and UC mice (Scale bar=50 μm). C: Comparison of the expression levels of the 10 hub genes in the colon tissues between control and UC mice. *P<0.05, **P<0.01, ***P<0.001 vs NC group.

Fig.9 Correlation analysis of colonic ferroptosis-related gene expression andtissue inflammation score in mice.

References 33

[1]	Aniwan S, Santiago P, Loftus EV Jr, et al. The epidemiology of inflammatory bowel disease in Asia and Asian immigrants to Western countries[J]. UEG J, 2022, 10(10): 1063-76. doi：10.1002/ueg2.12350
[2]	Gros B, Kaplan GG. Ulcerative colitis in adults[J]. Jama, 2023, 330(10): 951. doi：10.1001/jama.2023.15389
[3]	Dixon SJ, Lemberg KM, Lamprecht MR, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death[J]. Cell, 2012, 149(5): 1060-72. doi：10.1016/j.cell.2012.03.042
[4]	Wang S, Liu W, Wang J, et al. Curculigoside inhibits ferroptosis in ulcerative colitis through the induction of GPX4[J]. Life Sci, 2020, 259: 118356. doi：10.1016/j.lfs.2020.118356
[5]	Chen YJ, Yan WY, Chen YQ, et al. SLC6A14 facilitates epithelial cell ferroptosis via the C/EBPβ-PAK6 axis in ulcerative colitis[J]. Cell Mol Life Sci, 2022, 79(11): 563. doi：10.1007/s00018-022-04594-7
[6]	Xu M, Tao J, Yang Y, et al. Ferroptosis involves in intestinal epithelial cell death in ulcerative colitis[J]. Cell Death Dis, 2020, 11(2): 86. doi：10.1038/s41419-020-2299-1
[7]	Deng L, He S, Li Y, et al. Identification of lipocalin 2 as a potential ferroptosis-related gene in ulcerative colitis[J]. Inflamm Bowel Dis, 2023, 29(9): 1446-57. doi：10.1093/ibd/izad050
[8]	Chen YJ, Wang JY, Li JT, et al. Astragalus polysaccharide prevents ferroptosis in a murine model of experimental colitis and human Caco-2 cells via inhibiting NRF2/HO-1 pathway[J]. Eur J Pharmacol, 2021, 911: 174518. doi：10.1016/j.ejphar.2021.174518
[9]	Xu C, Liu Z, Xiao J. Ferroptosis: a double-edged sword in gastrointestinal disease[J]. Int J Mol Sci, 2021, 22(22): 12403. doi：10.3390/ijms222212403
[10]	Ni JH, Zhang LJ, Feng GZ, et al. Vanillic acid restores homeostasis of intestinal epithelium in colitis through inhibiting CA9/STIM1-mediated ferroptosis[J]. Pharmacol Res, 2024, 202: 107128. doi：10.1016/j.phrs.2024.107128
[11]	Long D, Mao CH, Huang YT, et al. Ferroptosis in ulcerative colitis: Potential mechanisms and promising therapeutic targets[J]. Biomed Pharmacother, 2024, 175: 116722. doi：10.1016/j.biopha.2024.116722
[12]	Ye Y, Liu L, Jing Y, et al. Ferroptosis: a therapeutic opportunity of inflammatory bowel disease[J]. Chin Med J: Engl, 2024, 137(7): 874-6. doi：10.1097/cm9.0000000000002998
[13]	Rahman MS, Alam MB, Kim YK, et al. Activation of Nrf2/HO-1 by peptide YD1 attenuates inflammatory symptoms through suppression of TLR4/MYyD88/NF‑κB signaling cascade[J]. Int J Mol Sci, 2021, 22(10): 5161. doi：10.3390/ijms22105161
[14]	Huang J, Zhang J, Ma J, et al. Inhibiting ferroptosis: a novel approach for ulcerative colitis therapeutics[J]. Oxid Med Cell Longev, 2022, 2022: 9678625. doi：10.1155/2022/9678625
[15]	黄柳芳, 吴博, 王莹. 儿童溃疡性结肠炎手术治疗的预测标志物分析[J]. 临床儿科杂志, 2025, 43(2): 120-7. doi：10.12372/jcp.2025.24e0051
[16]	Fajas L, Auboeuf D, Raspé E, et al. The organization, promoter analysis, and expression of the human PPARγ gene[J]. J Biol Chem, 1997, 272(30): 18779-89. doi：10.1074/jbc.272.30.18779
[17]	Saez E, Tontonoz P, Nelson MC, et al. Activators of the nuclear receptor PPARgamma enhance colon polyp formation[J]. Nat Med, 1998, 4(9): 1058-61. doi：10.1038/2042
[18]	Braissant O. Differential expression of peroxisome proliferator-activated receptor-, -, and -during rat embryonic development[J]. Endocrinology, 1998, 139(6): 2748-54. doi：10.1210/en.139.6.2748
[19]	Michalik L, Wahli W. Peroxisome proliferator-activated receptors: three isotypes for a multitude of functions[J]. Curr Opin Biotechnol, 1999, 10(6): 564-70. doi：10.1016/s0958-1669(99)00030-0
[20]	Zhang W, Gong M, Zhang W, et al. Thiostrepton induces ferroptosis in pancreatic cancer cells through STAT3/GPX4 signalling[J]. Cell Death Dis, 2022, 13(7): 630. doi：10.1038/s41419-022-05082-3
[21]	Ouyang SM, Li HX, Lou LL, et al. Inhibition of STAT3-ferroptosis negative regulatory axis suppresses tumor growth and alleviates chemoresistance in gastric cancer[J]. Redox Biol, 2022, 52: 102317. doi：10.1016/j.redox.2022.102317
[22]	Sugimoto K. Role of STAT3 in inflammatory bowel disease[J]. World J Gastroenterol, 2008, 14(33): 5110-4. doi：10.3748/wjg.14.5110
[23]	Alhouayek M, Buisseret B, Paquot A, et al. The endogenous bioactive lipid prostaglandin D₂-glycerol ester reduces murine colitisviaDP1 and PPARγ receptors[J]. FASEB J, 2018, 32(9): 5000-11. doi：10.1096/fj.201701205r
[24]	Farrokhyar F, Swarbrick ET, Irvine EJ. A critical review of epidemiological studies in inflammatory bowel disease[J]. Scand J Gastroenterol, 2001, 36(1): 2-15. doi：10.1080/00365520150218002
[25]	Cox DG, Crusius JB, Peeters PH, et al. Haplotype of prostaglandin synthase 2/cyclooxygenase 2 is involved in the susceptibility to inflammatory bowel disease[J]. World J Gastroenterol, 2005, 11(38): 6003-8. doi：10.3748/wjg.v11.i38.6003
[26]	Wallace JL. Prostaglandin biology in inflammatory bowel disease[J]. Gastroenterol Clin North Am, 2001, 30(4): 971-80. doi：10.1016/s0889-8553(05)70223-5
[27]	Feng D, Wang J, Li D, et al. Targeting prolyl 4-hydroxylase subunit beta (P4HB) in cancer: new roads to travel[J]. Aging Dis, 2023, 15(6): 2369-80.
[28]	Feng D, Li L, Li D, et al. Prolyl 4-hydroxylase subunit beta (P4HB) could serve as a prognostic and radiosensitivity biomarker for prostate cancer patients[J]. Eur J Med Res, 2023, 28(1): 245. doi：10.1186/s40001-023-01215-2
[29]	Butturini E, Carcereri de Prati A, Mariotto S. Redox regulation of STAT1 and STAT3 signaling[J]. Int J Mol Sci, 2020, 21(19): E7034. doi：10.3390/ijms21197034
[30]	Thuya WL, Cao Y, Ho PC, et al. Insights into IL-6/JAK/STAT3 signaling in the tumor microenvironment: Implications for cancer therapy[J]. Cytokine Growth Factor Rev, 2025, doi: 10.1016/j.cytogfr.2025.01.003 . Online ahead of print.
[31]	Zhang W, Gong M, Zhang W, et al. Thiostrepton induces ferroptosis in pancreatic cancer cells through STAT3/GPX4 signalling[J]. Cell Death Dis, 2022, 13(7): 630. doi：10.1038/s41419-022-05082-3
[32]	Ouyang SM, Li HX, Lou LL, et al. Inhibition of STAT3-ferroptosis negative regulatory axis suppresses tumor growth and alleviates chemoresistance in gastric cancer[J]. Redox Biol, 2022, 52: 102317. doi：10.1016/j.redox.2022.102317
[33]	Huang F, Zhang S, Li X, et al. STAT3-mediated ferroptosis is involved in ulcerative colitis[J]. Free Radic Biol Med, 2022, 188: 375-85. doi：10.1016/j.freeradbiomed.2022.06.242