Journal of Southern Medical University ›› 2026, Vol. 46 ›› Issue (1): 183-190.doi: 10.12122/j.issn.1673-4254.2026.01.20
Previous Articles Next Articles
Cheng ZHAO(
), Wen LI, Baoshou ZHENG, Guangming WANG, Zhisong XIAO, Yunpeng LI(
)
Received:2025-06-18
Online:2026-01-20
Published:2026-01-16
Contact:
Yunpeng LI
E-mail:3243330487@qq.com;lyp0872@163.com
Cheng ZHAO, Wen LI, Baoshou ZHENG, Guangming WANG, Zhisong XIAO, Yunpeng LI. Overexpression of lncRNA SNHG12 promotes docetaxel resistance of prostate cancer cells by activating PI3K/AKT signaling via interacting with ELAVL1[J]. Journal of Southern Medical University, 2026, 46(1): 183-190.
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.j-smu.com/EN/10.12122/j.issn.1673-4254.2026.01.20
| Genes | Primer (5'-3′) |
|---|---|
| SNHG12 | F:ATGAAATGCAGGGGACCTGG |
| R:TGTAACATGAATCTTAAAGCACAGC | |
| ELAVL1 | F:AACTACGTGACCGCGAAGG R:CGCCCAAACCGAGAGAACA |
| β-actin | F:CATGTACGTTGCTATCCAGGC |
| R:CTCCTTAATGTCACGCACGAT |
Tab.1 Primer sequences for RT-qPCR
| Genes | Primer (5'-3′) |
|---|---|
| SNHG12 | F:ATGAAATGCAGGGGACCTGG |
| R:TGTAACATGAATCTTAAAGCACAGC | |
| ELAVL1 | F:AACTACGTGACCGCGAAGG R:CGCCCAAACCGAGAGAACA |
| β-actin | F:CATGTACGTTGCTATCCAGGC |
| R:CTCCTTAATGTCACGCACGAT |
Fig.1 Construction of docetaxel-resistant PC-3 cells and identification of SNHG12 expression. A: CCK-8 assay for detecting cell viability. B: RT-qPCR for detecting expression of SNHG12 in PC-3 and PC-3R cells. n=3, ***P<0.001 vs PC-3 group.
Fig.2 Knockdown of SNHG12 inhibits docetaxel resistance in prostate cancer cells. A: Transfection efficiency of sh-SNHG12 detected by RT-qPCR. B: CCK-8 assay for assessing cell viability. C: Clone formation assay for assessing cell clone formation ability. D: Transwell assay for assessing cell migration ability (Scale bar=100 μm). n=3, **P<0.001, ***P<0.001 vs NC group; ###P<0.001 vs DTX group.
Fig.3 Knockdown of SNHG12 inhibits docetaxel resistance in prostate cancer cells through the PI3K/AKT signaling pathway. A: Western blotting for detecting expressions of p-PI3K/PI3K and p-AKT/AKT in PC-3 and PC-3R cells. B: CCK-8 assay for assessing viability of PC-3R cells. C: Clone formation assay for assessing clone formation ability of PC-3R cells. D: Transwell assay for assessing migration ability of PC-3R cells (Scale bar=100 μm). n=3, ***P<0.001 vs PC-3 group/DTX group; ##P<0.01, ###P<0.001 vs DTX+sh-SNHG12 group.
Fig.4 SNHG12 interacts with ELAVL1 to activate the PI3K/AKT signaling pathway. A: Immunofluorescence staining for detecting ELAVL1 expression in PC-3 and PC-3R cells (Scale bar=10 μm). B: RIP-qPCR for detecting enrichment level of SNHG12 on ELAVL1 in PC-3 and PC-3R cells. C: RT-qPCR for detecting transfection efficiency of sh-ELAVL1. D: Western blotting for detecting expressions of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells. n=3, **P<0.01, ***P<0.001 vs PC-3 group/IgG group/NC group.
Fig.5 Knockdown of SNHG12 inhibits docetaxel resistance in prostate cancer. A: Gross observation of the dissected tumors from the nude mouse models. B: Tumor volume changes in each group. C: Tumor weight changes in each group. D: Immunohistochemical detection of Ki67 expression in the tumor tissues in each group (Scale bar=25 μm). E: Western blotting for detecting expressions of p-PI3K/PI3K and p-AKT/AKT in the tumor tissues. n=5, *P<0.05, ***P<0.001 vs NC group; ###P<0.001 vs DTX group.
| [1] | Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-63. doi:10.3322/caac.21834 |
| [2] | Chen HT, Pang BR, Zhou C, et al. Prostate cancer-derived small extracellular vesicle proteins: the hope in diagnosis, prognosis, and therapeutics[J]. J Nanobiotechnology, 2023, 21(1): 480. doi:10.1186/s12951-023-02219-0 |
| [3] | Graham LS, Lin JK, Lage DE, et al. Management of prostate cancer in older adults[J]. Am Soc Clin Oncol Educ Book, 2023, 43: e390396. doi:10.1200/edbk_390396 |
| [4] | Sun XC, Zhang Y, Xin SY, et al. NOTCH3 promotes docetaxel resistance of prostate cancer cells through regulating TUBB3 and MAPK signaling pathway[J]. Cancer Sci, 2024, 115(2): 412-26. doi:10.1111/cas.16040 |
| [5] | Lu JH, Zou QR, Li Y, et al. FTH1P8 induces and transmits docetaxel resistance by inhibiting ferroptosis in prostate cancer[J]. Biomed Pharmacother, 2024, 180: 117472. doi:10.1016/j.biopha.2024.117472 |
| [6] | Hashemi M, Zandieh MA, Talebi Y, et al. Paclitaxel and docetaxel resistance in prostate cancer: Molecular mechanisms and possible therapeutic strategies[J]. Biomed Pharmacother, 2023, 160: 114392. doi:10.1016/j.biopha.2023.114392 |
| [7] | Zhang YG. LncRNA-encoded peptides in cancer[J]. J Hematol Oncol, 2024, 17(1): 66. doi:10.1186/s13045-024-01591-0 |
| [8] | Tamang S, Acharya V, Roy D, et al. SNHG12: an LncRNA as a potential therapeutic target and biomarker for human cancer[J]. Front Oncol, 2019, 9: 901. doi:10.3389/fonc.2019.00901 |
| [9] | Cheng G, Song ZS, Liu YN, et al. Long noncoding RNA SNHG12 indicates the prognosis of prostate cancer and accelerates tumorigenesis via sponging miR-133b[J]. J Cell Physiol, 2020, 235(2): 1235-46. doi:10.1002/jcp.29039 |
| [10] | Song JN, Wu XH, Ma R, et al. Long noncoding RNA SNHG12 promotes cell proliferation and activates Wnt/β-catenin signaling in prostate cancer through sponging microRNA-195[J]. J Cell Biochem, 2019, 120(8): 13066-75. doi:10.1002/jcb.28578 |
| [11] | Li KY, Wang Q, Tang XY, et al. Advances in prostate cancer biomarkers and probes[J]. Cyborg Bionic Syst, 2024, 5: 0129. doi:10.34133/cbsystems.0129 |
| [12] | Wang P, Chen D, Ma HB, et al. LncRNA SNHG12 contributes to multidrug resistance through activating the MAPK/Slug pathway by sponging miR-181a in non-small cell lung cancer[J]. Oncotarget, 2017, 8(48): 84086-101. doi:10.18632/oncotarget.20475 |
| [13] | Lebedeva S, Jens M, Theil K, et al. Transcriptome-wide analysis of regulatory interactions of the RNA-binding protein HuR[J]. Mol Cell, 2011, 43(3): 340-52. doi:10.1016/j.molcel.2011.06.008 |
| [14] | Ma S, Xu YH, Qin XY, et al. RUNX1, FUS, and ELAVL1-induced circPTPN22 promote gastric cancer cell proliferation, migration, and invasion through miR-6788-5p/PAK1 axis-mediated autophagy[J]. Cell Mol Biol Lett, 2024, 29(1): 95. doi:10.1186/s11658-024-00610-9 |
| [15] | Kanzaki H, Chiba T, Kaneko T, et al. The RNA-binding protein ELAVL1 regulates hepatitis B virus replication and growth of hepatocellular carcinoma cells[J]. Int J Mol Sci, 2022, 23(14): 7878. doi:10.3390/ijms23147878 |
| [16] | Mao GX, Mu ZM, Wu DA. Exosomal lncRNA FOXD3-AS1 upregulates ELAVL1 expression and activates PI3K/Akt pathway to enhance lung cancer cell proliferation, invasion, and 5-fluorouracil resistance[J]. Acta Biochim Biophys Sin (Shanghai), 2021, 53(11): 1484-94. doi:10.1093/abbs/gmab129 |
| [17] | Cai ZL, Xu H, Bai G, et al. ELAVL1 promotes prostate cancer progression by interacting with other m6A regulators[J]. Front Oncol, 2022, 12: 939784. doi:10.3389/fonc.2022.939784 |
| [18] | Wei LJ, Zhang Q, Zhong CC, et al. Functional inhibition of the RNA-binding protein HuR sensitizes triple-negative breast cancer to chemotherapy[J]. Mol Oncol, 2023, 17(10): 1962-80. doi:10.1002/1878-0261.13478 |
| [19] | Huang YS, Xia L, Tan XW, et al. Molecular mechanism of lncRNA SNHG12 in immune escape of non-small cell lung cancer through the HuR/PD-L1/USP8 axis[J]. Cell Mol Biol Lett, 2022, 27(1): 43. doi:10.1186/s11658-022-00343-7 |
| [20] | Li MX, Che N, Liu XZ, et al. Dauricine regulates prostate cancer progression by inhibiting PI3K/AKT-dependent M2 polarization of macrophages[J]. Biochem Pharmacol, 2023, 217: 115838. doi:10.1016/j.bcp.2023.115838 |
| [21] | Eberlein C, Williamson SC, Hopcroft L, et al. Capivasertib combines with docetaxel to enhance anti-tumour activity through inhibition of AKT-mediated survival mechanisms in prostate cancer[J]. Br J Cancer, 2024, 130(8): 1377-87. doi:10.1038/s41416-024-02614-w |
| [22] | Lu XX, Yang FY, Chen DX, et al. Quercetin reverses docetaxel resistance in prostate cancer via androgen receptor and PI3K/Akt signaling pathways[J]. Int J Biol Sci, 2020, 16(7): 1121-34. doi:10.7150/ijbs.41686 |
| [23] | Brady SN, Maggi LB Jr, Winkeler CL, et al. Nucleophosmin protein expression level, but not threonine 198 phosphorylation, is essential in growth and proliferation[J]. Oncogene, 2009, 28(36): 3209-20. doi:10.1038/onc.2009.178 |
| [24] | Shi Q, Zhu YS, Ma J, et al. Prostate Cancer-associated SPOP mutations enhance cancer cell survival and docetaxel resistance by upregulating Caprin1-dependent stress granule assembly[J]. Mol Cancer, 2019, 18(1): 170. doi:10.1186/s12943-019-1096-x |
| [25] | Sun D, Fan XH. LncRNA SNHG12 accelerates the progression of ovarian cancer via absorbing miRNA-129 to upregulate SOX4[J]. Eur Rev Med Pharmacol Sci, 2019, 23(6): 2345-52. |
| [26] | Wang JZ, Xu CL, Wu H, et al. LncRNA SNHG12 promotes cell growth and inhibits cell apoptosis in colorectal cancer cells[J]. Braz J Med Biol Res, 2017, 50(3): e6079. doi:10.1590/1414-431x20176079 |
| [27] | Peng Y, Wang YY, Zhou C, et al. PI3K/Akt/mTOR pathway and its role in cancer therapeutics: are we making headway?[J]. Front Oncol, 2022, 12: 819128. doi:10.3389/fonc.2022.819128 |
| [28] | Li HY, Shen X, Ma MJ, et al. ZIP10 drives osteosarcoma proliferation and chemoresistance through ITGA10-mediated activation of the PI3K/AKT pathway[J]. J Exp Clin Cancer Res, 2021, 40(1): 340. doi:10.1186/s13046-021-02146-8 |
| [29] | Okuno K, Xu CM, Pascual-Sabater S, et al. Berberine overcomes gemcitabine-associated chemoresistance through regulation of Rap1/PI3K-Akt signaling in pancreatic ductal adenocarcinoma[J]. Pharmaceuticals (Basel), 2022, 15(10): 1199. doi:10.3390/ph15101199 |
| [30] | Yin HL, Qin HX, Yang L, et al. circCYP24A1 promotes Docetaxel resistance in prostate Cancer by Upregulating ALDH1A3[J]. Biomark Res, 2022, 10(1): 48. doi:10.1186/s40364-022-00393-1 |
| [31] | Li YZ, Guo SQ, Liu WC, et al. Silencing of SNHG12 enhanced the effectiveness of MSCs in alleviating ischemia/reperfusion injuries via the PI3K/AKT/mTOR signaling pathway[J]. Front Neurosci, 2019, 13: 645. doi:10.3389/fnins.2019.00645 |
| [32] | Cai ZL, Zhai XX, Xu JD, et al. ELAVL1 regulates PD-L1 mRNA stability to disrupt the infiltration of CD4-positive T cells in prostate cancer[J]. Neoplasia, 2024, 57: 101049. doi:10.1016/j.neo.2024.101049 |
| [33] | Wei LJ, Kim SH, Armaly AM, et al. RNA-binding protein HuR inhibition induces multiple programmed cell death in breast and prostate cancer[J]. Cell Commun Signal, 2024, 22(1): 580. doi:10.1186/s12964-024-01916-z |
| [1] | Zixian CHEN, Jiawei ZHOU, Lei TAN, Zhipeng HUANG, Kangyi XUE, Mingkun CHEN. A risk prediction model for prognosis and immunotherapy response in prostate cancer patients based on immunosuppressive neutrophil Neu_2 subsets [J]. Journal of Southern Medical University, 2025, 45(8): 1643-1653. |
| [2] | Xuan GUO, Yang LIU, Yan XIONG, Biaoshui LIU, Ting SONG, Yunfei LI. Analysis of setup errors and their correlation with clinical factors in image-guided radiotherapy for prostate cancer using different immobilization devices [J]. Journal of Southern Medical University, 2025, 45(12): 2718-2725. |
| [3] | Jinguang LUO, Huaixiang TAO, Zhiyuan WEN, Long CHEN, Hao HU, Han GUAN. Tumor-associated fibroblasts promotes proliferation and migration of prostate cancer cells by suppressing FBXL3 via upregulating hsa-miR-18b-5p [J]. Journal of Southern Medical University, 2024, 44(7): 1284-1296. |
| [4] | Yong ZHOU, Yuan WU, huiwen ZENG, Cuimei CHEN, Qun XIE, Liping HE. Analysis of Clostridioides difficile infection characteristics and risk factors in patients hospitalized for diarrhea in 3 university hospitals in a mid-south city of China [J]. Journal of Southern Medical University, 2024, 44(5): 998-1003. |
| [5] | DA Rong, ZHOU Yi, CHENG Yue, LV Jia, HAN Bei. UhpTE350Q mutation along with the presence of fosA6/5 genes in the genome probably contributes to inherent fosfomycin resistance of Klebsiella pneumoniae [J]. Journal of Southern Medical University, 2023, 43(7): 1110-1115. |
| [6] | JIANG Yong, GE Wenting, ZHAO Ying, WU Yuge, HUO Yiming, PAN Lanting, CAO Shuang. LINC00926 promotes pyroptosis of hypoxia-induced human umbilical vein vascular endothelial cells by recruiting ELAVL1 [J]. Journal of Southern Medical University, 2023, 43(5): 807-814. |
| [7] | XIN Chen, WANG Xiaoying, LI Xiang, CHEN Yu, WANG Xue, NING Jiaxi, YANG Shi, WANG Zhongqiong. Silencing SIRT1 reduces 5-fluorouracil resistance of cholangiocarcinoma cells by inhibiting the FOXO1/Rab7 autophagy pathway [J]. Journal of Southern Medical University, 2023, 43(3): 454-459. |
| [8] | ZHAO Qilin, WANG Nan, LI Yaji, WU Qingchen, WU Lanxiang. Lnc-TMEM132D-AS1 overexpression reduces sensitivity of non-small cell lung cancer cells to osimertinib [J]. Journal of Southern Medical University, 2023, 43(2): 242-250. |
| [9] | SUN Jiangchuan, XING Jiaheng, TAN Ruxue, QIAN Ying, TIAN Nan. Curcumol reverses temozolomide resistance in glioma cells by regulating the UTX/MGMT axis [J]. Journal of Southern Medical University, 2023, 43(10): 1697-1705. |
| [10] | XIE Yan, LI Cheng, ZHANG Lulu, ZANG Shiming, YU Fei, WANG Shukui, WANG Feng. 68Ga-PSMA-I&T PET/CT for assessment of tumor burden in primary lesions of treatment-naïve prostate cancer [J]. Journal of Southern Medical University, 2022, 42(8): 1143-1148. |
| [11] | YANG Ming, ZHU Xudong, SHEN Yang, HE Qi, QIN Yuan, SHAO Yiqun, YUAN Lin, YE Hesong. High expression of MYBL2 promotes progression and predicts a poor survival outcome of prostate cancer [J]. Journal of Southern Medical University, 2022, 42(8): 1109-1118. |
| [12] | ZHANG Mingliang, GUO Chenxu, CHU Yunmian, XU Rui, YIN Faxiang, QIAN Jun. Dihydromyricetin reverses Herceptin resistance by up-regulating miR-98-5p and inhibiting IGF1R/HER2 dimer formation in SKBR3 cells [J]. Journal of Southern Medical University, 2022, 42(2): 207-214. |
| [13] | ZHU Haitao, MAO Huilan, TAO Shuang, WANG Wenrui, CHEN Changjie, YANG Qingling. miR-16-5p regulates apoptosis and migration of drug-resistant breast cancer cells by targeting YWHAQ [J]. Journal of Southern Medical University, 2022, 42(10): 1476-1485. |
| [14] | YANG Jian, ZENG Yan, WU Xiaoling, WANG Zhigang. Effect of DR5-mediated docetaxel-loaded lipid microbubble combined with ultrasound-targeted microbubble destruction on HepG2 cell proliferation and apoptosis [J]. Journal of Southern Medical University, 2021, 41(8): 1220-1225. |
| [15] | . Fucoxanthin induces prostate cancer PC-3 cell apoptosis by causing mitochondria dysfunction and oxidative stress [J]. Journal of Southern Medical University, 2021, 41(6): 953-959. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||