Tumor-associated fibroblasts promotes proliferation and migration of prostate cancer cells by suppressing FBXL3 via upregulating hsa-miR-18b-5p

doi:10.12122/j.issn.1673-4254.2024.07.08

Abstract

Abstract:

Objective To explore the mechanism of tumor-associated fibroblasts (CAFs) for regulating proliferation and migration of prostate cancer (PCa) cells. Methods We conducted a bioinformatics analysis to identify miRNAs with high expression in PCa. The proliferation, migration and hsa-miR-18b-5p expression levels were observed in PCa cells co-cultured with CAFs. We further examined hsa-miR-18b-5p expression level in 20 pairs of PCa and adjacent tissue samples and in different PCa cell lines and normal epithelial cells using RT-qPCR. In PCa cell lines C4-2 and LNCAPNC, the effects of transfection with a hsa-miR-18b-5p inhibitor on cell proliferation, migration, invasion, drug resistance, apoptosis and cell cycle were evaluated, and the effects of has-miR-18b-5p knockdown on C4-2 cell xenograft growth and mouse survival were observed in nude mice. Dual luciferase reporter gene assay was used to validate the targeting relationship between hsa-miR-18b-5p and its target genes, whose expressions were detected in PCa cells using RT-qPCR and Western blotting. Results The expression of hsa-miR-18b-5p was significantly increased in the co-culture of CAFs and PCa cell lines, which exhibited significantly enhanced proliferation and migration abilities. Transfection with has-miR-18b-5p inhibitor strongly attenuated the effect of CAFs for promoting proliferation and migration of PCa cells, and in C4-2 and LNCAP cells cultured alone, inhibition of hsa-miR-18b-5p obviously suppressed cell proliferation, migration, invasion, and drug resistance. In the tumor-bearing mice, hsa-miR-18b-5p knockdown in the transplanted cells significantly inhibited xenograft growth and increased the survival time of the mice. Target gene prediction suggested that FBXL3 was a potential target of hsa-miR-18b-5p, and dual luciferase reporter gene confirmed a binding site between them. In C4-2 and LNCAP cells, hsa-miR-18b-5p knockdown resulted in significantly increased expression levels of FBXL3. Conclusion CAFs promotes proliferation and migration of PCa cells by up-regulating hsa-miR-18b-5p to suppress FBXL3 expression.

Key words: hsa-miR-18b-5p, tumor-associated fibroblasts, FBXL3, prostate cancer, promoting cancer

Jinguang LUO, Huaixiang TAO, Zhiyuan WEN, Long CHEN, Hao HU, Han GUAN. Tumor-associated fibroblasts promotes proliferation and migration of prostate cancer cells by suppressing FBXL3 via upregulating hsa-miR-18b-5p[J]. Journal of Southern Medical University, 2024, 44(7): 1284-1296.

Figures/Tables 13

Tab.1 Primer sequences for RT-qPCR

Gene	Primer sequence 5'-3'
hsa-miR-18b-5p	F: AGGCGCATTAAGGTGCATCTAGT
hsa-miR-18b-5p	R: ATCCAGTGCAGGGTCCGAGG
has-miR-148a	F: TCTGAGACACTCCGACTCTG
has-miR-148a	R: AGTTCTGTAGTGCACTGACTTCT
has-miR-17	F: AAGTGCTTACAGTGCAGGTAGT
has-miR-17	R: GTCACCATAATGCTACAAGTGC
has-miR-770	F: CCTCCAGTACCACGTGTCAG
has-miR-770	R: CCCCAGCACCACATCAGG
has-miR-297-3p	F: AGTGCTTACAGTGCAGGTAGT
has-miR-297-3p	R: TCACCATAATGCTACAAGTGCC
U6	F: GCTTCGGCAGCACATATACTAAAAT
U6	R: CGCTTCACGAATTTGCGTGTCAT
FBXL3	F: ATGCTTCACAAGTTTGCCGC
FBXL3	R: CACGGCCAAGCACATCTTTG
GAPDH	F: TCATGACCACAGTCCATGCC
GAPDH	R: TTCTAGACGGCAGGTCAGGT

Fig.1 Volcano plot and heat map of the differential miRNAs in prostate cancer. A: Differential miRNA heat map in prostate cancer. B: Volcano plot of differential miRNA in prostate cancer.

Fig.2 Identification of CAFs and NFs and co-cultured prostate cancer C4-2 cells. A: Morphology of CAFs and NFs were observed under light microscope. B, C: Expression of vimentin and α-SMA in CAFs and NFs detected by Western blotting. D: RT-qPCR for detecting vimentin and α-SMA mRNAs in co-cultures of C4-2 cells with CAFs or NFs. *P<0.05, **P<0.01.

Fig.3 Effect of CAFs on proliferation and migration of PCa cells. A, B: Colony formation assays of C4-2 cells co-cultured with CAFs. C, D: Transwell migration assay of C4-2 cells co-cultured with CAFs. **P<0.01.

Fig.4 Knocking down has-miR-18b-5p attenuates the effect of CAFs on proliferation and migration of PCa cells. A, B: Colony formation assays of CAFs co-cultured with C4-2 cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. C, D: Transwell migration assays of CAFs co-cultured with C4-2 cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. **P<0.01.

Fig.5 Expression of hsa-miR-18b-5p in prostate cancer cell lines and clinical tumor tissues. A: Expression of hsa-miR-18b-5p in clinical tumor tissues. B: Expression of hsa-miR-18b-5p in prostate cancer cell lines. *P<0.05, **P<0.01 vs BPH-1 group.

Fig.6 Effect of Has-miR-18b-5p on proliferation of prostate cancer cells. A: CCK-8 assay of C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. B, C: Colony formation assay of C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. *P<0.05, **P<0.01.

Fig.7 Effect of hsa-miR-18b-5p on migration and invasion of prostate cancer cells. A,B: Wound-healing assay of C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. C, E: Transwell migration assay of C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. D, F: Transwell invasion assay of in C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. *P<0.05, **P<0.01.

Fig.8 Effect of hsa-miR-18b-5p on enzalutamide resistance of prostate cancer cells.

Fig.9 Effect of hsa-miR-18b-5p on apoptosis and cell cycle of prostate cancer cells. A,B: Apoptosis assays of C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. C-F: Cell cycle assays of C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. *P<0.05, **P<0.01.

Fig.10 Effect of hsa-miR-18b-5p on tumor load in nude mice. A,B: Tumor weight in mice. C: Tumor volume in mice. D: Kaplan-Meier survival curve analysis of survival of the mice. *P<0.05, **P<0.01.

Fig.11 Targeting relationship between hsa-miR-18b-5p and FBXL3 in prostate cancer. A: Wayne diagram of hsa-miR-18b-5p target gene. B: Binding sites of hsa-miR-18b-5p and FBXL3. C: Results of dual luciferase reporter assay. D: RT-qPCR of FBXL3 in C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. E,F: Western blotting of FBXL3 in C4-2 and LNCAP cells transfected with NC inhibitor and hsa-miR-18b-5p inhibitor. *P<0.05, **P<0.01.

Fig.12 Overexpression of FBXL3 reverses the effects of hsa-miR-18b-5p knockdown in prostate cancer cell line. A: CCK8 assay of the two co-transfected PCa cell lines. B: Transwell assay of the two co-transfected PCa cell lines. C: Wound healing assay of the two co-transfected PCa cell lines. *P<0.05.

References 48

1	Sehn JK. Prostate cancer pathology: recent updates and controversies[J]. Mo Med, 2018, 115(2): 151-5.
2	Kimura T, Egawa S. Epidemiology of prostate cancer in Asian countries[J]. Int J Urol, 2018, 25(6): 524-31.
3	Zelic R, Garmo H, Zugna D, et al. Predicting prostate cancer death with different pretreatment risk stratification tools: a head-to-head comparison in a nationwide cohort study[J]. Eur Urol, 2020, 77(2): 180-8.
4	Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-49.
5	Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020[J]. CA Cancer J Clin, 2020, 70(1): 7-30.
6	Taylor LG, Canfield SE, Du XL. Review of major adverse effects of androgen-deprivation therapy in men with prostate cancer[J]. Cancer, 2009, 115(11): 2388-99.
7	Zarour L, Alumkal J. Emerging therapies in castrate-resistant prostate cancer[J]. Curr Urol Rep, 2010, 11(3): 152-8.
8	Boulos S, Mazhar D. The evolving role of chemotherapy in prostate cancer[J]. Future Oncol, 2017, 13(12): 1091-5.
9	Sebesta EM, Anderson CB. The surgical management of prostate cancer[J]. Semin Oncol, 2017, 44(5): 347-57.
10	Shevach J, Chaudhuri P, Morgans AK. Adjuvant therapy in high-risk prostate cancer[J]. Clin Adv Hematol Oncol, 2019, 17(1): 45-53.
11	Chistiakov DA, Myasoedova VA, Grechko AV, et al. New biomarkers for diagnosis and prognosis of localized prostate cancer[J]. Semin Cancer Biol, 2018, 52(Pt 1): 9-16.
12	Michlewski G, Cáceres JF. Post-transcriptional control of miRNA biogenesis[J]. RNA, 2019, 25(1): 1-16.
13	Liu T, Zhang Q, Zhang JK, et al. EVmiRNA: a database of miRNA profiling in extracellular vesicles[J]. Nucleic Acids Res, 2019, 47(D1): D89-93.
14	Ali Syeda Z, Langden SSS, Munkhzul C, et al. Regulatory mechanism of microRNA expression in cancer[J]. Int J Mol Sci, 2020, 21(5): 1723-9.
15	Friedman RC, Farh KKH, Burge CB, et al. Most mammalian mRNAs are conserved targets of microRNAs[J]. Genome Res, 2009, 19(1): 92-105.
16	Cocks A, Del Vecchio F, Martinez-Rodriguez V, et al. Pro-tumoral functions of tumor-associated macrophage EV-miRNA[J]. Semin Cancer Biol, 2022, 86(Pt 1): 58-63.
17	Del Valle-Morales D, Le P, Saviana M, et al. The epitranscriptome in miRNAs: crosstalk, detection, and function in cancer[J]. Genes, 2022, 13(7): 1289-95.
18	Smolarz B, Durczyński A, Romanowicz H, et al. miRNAs in cancer (review of literature)[J]. Int J Mol Sci, 2022, 23(5): 2805-13.
19	Iqbal MA, Arora S, Prakasam G, et al. MicroRNA in lung cancer: role, mechanisms, pathways and therapeutic relevance[J]. Mol Aspects Med, 2019, 70: 3-20.
20	Kt RD, Karthick D, Saravanaraj KS, et al. The roles of microRNA in pancreatic cancer progression[J]. Cancer Invest, 2022, 40(8): 700-9.
21	Ismail A, Abulsoud AI, Fathi D, et al. The role of miRNAs in ovarian cancer pathogenesis and therapeutic resistance-A focus on signaling pathways interplay[J]. Pathol Res Pract, 2022, 240: 154222.
22	Hwang GR, Yuen JG, Ju JF. Roles of microRNAs in gastrointestinal cancer stem cell resistance and therapeutic development[J]. Int J Mol Sci, 2021, 22(4): 1624-36.
23	Doghish AS, Ismail A, El-Mahdy HA, et al. A review of the biological role of miRNAs in prostate cancer suppression and progression[J]. Int J Biol Macromol, 2022, 197: 141-56.
24	Mao XQ, Xu J, Wang W, et al. Crosstalk between cancer-associated fibroblasts and immune cells in the tumor microenvironment: new findings and future perspectives[J]. Mol Cancer, 2021, 20(1): 131-8.
25	Tsoumakidou M. The advent of immune stimulating CAFs in cancer[J]. Nat Rev Cancer, 2023, 23(4): 258-69.
26	Wang YF, Liang HY, Zheng J. Exosomal microRNAs mediating crosstalk between cancer cells and cancer-associated fibroblasts in the tumor microenvironment[J]. Pathol Res Pract, 2022, 239: 154159.
27	Bullock MD, Pickard KM, Nielsen BS, et al. Pleiotropic actions of miR-21 highlight the critical role of deregulated stromal microRNAs during colorectal cancer progression[J]. Cell Death Dis, 2013, 4(6): e684-92.
28	Gandellini P, Giannoni E, Casamichele A, et al. MiR-205 hinders the malignant interplay between prostate cancer cells and associated fibroblasts[J]. Antioxid Redox Signal, 2014, 20(7): 1045-59.
29	Yan ZQ, Sheng ZM, Zheng YH, et al. Cancer-associated fibroblast-derived exosomal miR-18b promotes breast cancer invasion and metastasis by regulating TCEAL7[J]. Cell Death Dis, 2021, 12(12): 1120-32.
30	Xue F, Xu YH, Shen CC, et al. Non-coding RNA LOXL1-AS1 exhibits oncogenic activity in ovarian cancer via regulation of miR-18b-5p/VMA21 axis[J]. Biomedecine Pharmacother, 2020, 125: 109568.
31	Wang YY, Yan L, Yang S, et al. Long noncoding RNA AC073284.4 suppresses epithelial-mesenchymal transition by sponging miR-18b-5p in paclitaxel-resistant breast cancer cells[J]. J Cell Physiol, 2019, 234(12): 23202-15.
32	Komura K, Sweeney CJ, Inamoto T, et al. Current treatment strategies for advanced prostate cancer[J]. Int J Urol, 2018, 25(3): 220-31.
33	Swarbrick S, Wragg N, Ghosh S, et al. Systematic review of miRNA as biomarkers in Alzheimer's disease[J]. Mol Neurobiol, 2019, 56(9): 6156-67.
34	Pottoo FH, Iqubal A, Iqubal MK, et al. miRNAs in the regulation of cancer immune response: effect of miRNAs on cancer immunotherapy[J]. Cancers, 2021, 13(23): 6145-56.
35	Khan AQ, Ahmed EI, Elareer NR, et al. Role of miRNA-regulated cancer stem cells in the pathogenesis of human malignancies[J]. Cells, 2019, 8(8): 840-8.
36	Hussen BM, Hidayat HJ, Salihi A, et al. MicroRNA: a signature for cancer progression[J]. Biomedecine Pharmacother, 2021, 138: 111528.
37	Liang Y, Lu Q, Li W, et al. Reactivation of tumour suppressor in breast cancer by enhancer switching through NamiRNA network[J]. Nucleic Acids Res, 2021, 49(15): 8556-72.
38	Hu HH, Cheng RJ, Wang YB, et al. Oncogenic KRAS signaling drives evasion of innate immune surveillance in lung adenocarcinoma by activating CD47[J]. J Clin Invest, 2023, 133(2): e153470.
39	Liu LN, Zhang Y, Hu X, et al. MiR-138-5p inhibits prostate cancer cell proliferation and chemoresistance by targeting APOBEC3B[J]. Transl Oncol, 2023, 35: 101723-36.
40	Li WJ, Liu XZ, Dougherty EM, et al. MicroRNA-34a, prostate cancer stem cells, and therapeutic development[J]. Cancers, 2022, 14(18): 4538-50.
41	Angel CZ, Stafford MYC, McNally CJ, et al. MiR-21 is induced by hypoxia and down-regulates RHOB in prostate cancer[J]. Cancers, 2023, 15(4): 1291-309.
42	Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation[J]. Cell, 2011, 144(5): 646-74.
43	Cirri P, Chiarugi P. Cancer-associated-fibroblasts and tumour cells: a diabolic liaison driving cancer progression[J]. Cancer Metastasis Rev, 2012, 31(1/2): 195-208.
44	Aprelikova O, Yu X, Palla J, et al. The role of miR-31 and its target gene SATB2 in cancer-associated fibroblasts[J]. Cell Cycle, 2010, 9(21): 4387-98.
45	Bronisz A, Godlewski J, Wallace JA, et al. Reprogramming of the tumour microenvironment by stromal PTEN-regulated miR-320[J]. Nat Cell Biol, 2011, 14(2): 159-67.
46	Yao Q, Cao SY, Li C, et al. Micro-RNA-21 regulates TGF-β-induced myofibroblast differentiation by targeting PDCD4 in tumor-stroma interaction[J]. Int J Cancer, 2011, 128(8): 1783-92.
47	Wang DZ, Han X, Li C, et al. FBXL3 is regulated by miRNA-4735-3p and suppresses cell proliferation and migration in non-small cell lung cancer[J]. Pathol Res Pract, 2019, 215(2): 358-65.
48	Huber AL, Papp SJ, Chan AB, et al. CRY2 and FBXL3 cooperatively degrade c-MYC[J]. Mol Cell, 2016, 64(4): 774-89.

[1]	XIE Yan, LI Cheng, ZHANG Lulu, ZANG Shiming, YU Fei, WANG Shukui, WANG Feng. ⁶⁸Ga-PSMA-I&T PET/CT for assessment of tumor burden in primary lesions of treatment-naïve prostate cancer [J]. Journal of Southern Medical University, 2022, 42(8): 1143-1148.
[2]	YANG Ming, ZHU Xudong, SHEN Yang, HE Qi, QIN Yuan, SHAO Yiqun, YUAN Lin, YE Hesong. High expression of MYBL2 promotes progression and predicts a poor survival outcome of prostate cancer [J]. Journal of Southern Medical University, 2022, 42(8): 1109-1118.
[3]	. Fucoxanthin induces prostate cancer PC-3 cell apoptosis by causing mitochondria dysfunction and oxidative stress [J]. Journal of Southern Medical University, 2021, 41(6): 953-959.
[4]	XU Binbing, HAO Jinglan, XIE Qianwen, SA Naer, WANG Shiyu, DU Xiaowen, LU Haicheng, GAO Ping, SHI Guangyao, DONG Xiaoming. EEFSEC knockdown inhibits proliferation, migration and invasion of prostate cancer cells in vitro [J]. Journal of Southern Medical University, 2021, 41(12): 1787-1794.
[5]	ZHANG Heyuan, CHEN Nanhui, WANG Xiaohong, GAO Baiyun, LING Muan, CHEN Guo, WU Zhiming, LI Yutong, ZHONG Weifeng, PAN Bin. Identification and validation of hub genes in prostate cancer progression based on weighted gene co-expression network analysis [J]. Journal of Southern Medical University, 2021, 41(11): 1631-1640.
[6]	. Metformin inhibits proliferation and functions of regulatory T cells in acidic environment [J]. Journal of Southern Medical University, 2019, 39(12): 1427-1435.
[7]	. Prediction of rectal toxicity of radiotherapy for prostate cancer based on multi-modality feature and multi-classifiers [J]. Journal of Southern Medical University, 2019, 39(08): 972-.
[8]	. Citron Rho-interacting serine/threonine kinase knockdown suppresses prostate cancer cell proliferation and metastasis by blocking Hippo-YAPpathway [J]. Journal of Southern Medical University, 2019, 39(03): 257-.
[9]	. MTBP regulates migration and invasion of prostate cancer cells in vitro [J]. Journal of Southern Medical University, 2019, 39(01): 6-.
[10]	. Infiltrating mast cells promote neuroendocrine differentiation and increase docetaxel resistance of prostate cancer cells by up-regulating p21 [J]. Journal of Southern Medical University, 2018, 38(06): 723-.
[11]	. Establishment of mouse model of bone metastasis of prostate cancer and breast cancer via femoral artery injection of tumor cells [J]. Journal of Southern Medical University, 2017, 37(07): 914-.
[12]	. Effect of androgen receptor on IgG expression, proliferation and migration of prostate cancer cells in vitro [J]. Journal of Southern Medical University, 2017, 37(03): 388-.
[13]	. Effect of sodium phenylbutyrate on the sensitivity of PC3/DTX-resistant prostate cancer cells to docetaxel [J]. Journal of Southern Medical University, 2017, 37(01): 130-.
[14]	. Small RNA interference-mediated ADP-ribosylation factor 6 silencing inhibits proliferation, migration and invasion of human prostate cancer PC-3 cells [J]. Journal of Southern Medical University, 2016, 36(06): 735-.
[15]	. Solanine inhibits prostate cancer Du145 xenograft growth in nude mice by inducing cell cycle arrest in G1/S phase [J]. Journal of Southern Medical University, 2016, 36(05): 665-.