Overexpression of lncRNA SNHG12 promotes docetaxel resistance of prostate cancer cells by activating PI3K/AKT signaling via interacting with ELAVL1

doi:10.12122/j.issn.1673-4254.2026.01.20

Abstract

Abstract:

Objective To investigate the regulatory role of lncRNA SNHG12 in docetaxel (DTX) resistance of prostate cancer (PCa) cells. Methods Tumor-bearing male BALB/c nude mouse models were stablished by dorsal subcutaneous injection of PC-3 cells or DTX-resistant PC-3 (PC-3R) cells, either with or without transfection with sh-SNHG12 prior to the injection (n=5). The expressions of the key genes and proteins in the tumor tissues were detected using RT-qPCR, Western blotting, immunofluorescence staining or immunohistochemistry. The proliferation and migration of the treated cells were evaluated with CCK-8, clone formation and Transwell migration assays. RIP-qPCR technique was used to determine the binding between the RNAs and proteins. Results SNHG12 expression was significantly up-regulated in PC-3R cells. SNHG12 knockdown effectively inhibited proliferation and migration of PC-3R cells in vitro and suppressed tumor growth in nude mice. While 10 nmol/L DTX treatment alone did not significantly affect proliferation or migration of PC-3R cells, its combination with SNHG12 knockdown strongly inhibited cell proliferation and migration both in vitro and in the tumor-bearing mice. The expression of ELAVL1 was obviously up-regulated in PC-3R cells, and increased activation level of PI3K/AKT signaling pathway was detected in both PC-3R cells and the xenografts. The effect of SNHG12 knockdown was significantly weakened by treatment with the PI3K activator 740 Y-P. SNHG12 was found to bind to ELAVL1 in PC-3R cells, and mechanistic studies showed that their binding activated the PI3K/AKT signaling pathway to result in DTX resistance in PCa. Conclusion SNHG12 knockdown inhibits DTX resistance of PCa cells by reducing SNHG12 binding to ELAVL1 to inhibit the activation the PI3K/AKT signaling pathway.

Key words: prostate cancer, drug resistance, docetaxel, lncRNA SNHG12, ELAVL1, PI3K / AKT signaling pathway

Cheng ZHAO, Wen LI, Baoshou ZHENG, Guangming WANG, Zhisong XIAO, Yunpeng LI. Overexpression of lncRNA SNHG12 promotes docetaxel resistance of prostate cancer cells by activating PI3K/AKT signaling via interacting with ELAVL1[J]. Journal of Southern Medical University, 2026, 46(1): 183-190.

Figures/Tables 6

Tab.1 Primer sequences for RT-qPCR

Genes	Primer (5'-3′)
SNHG12	F:ATGAAATGCAGGGGACCTGG
SNHG12	R:TGTAACATGAATCTTAAAGCACAGC
ELAVL1	F:AACTACGTGACCGCGAAGG R:CGCCCAAACCGAGAGAACA
β-actin	F:CATGTACGTTGCTATCCAGGC
β-actin	R:CTCCTTAATGTCACGCACGAT

Fig.1 Construction of docetaxel-resistant PC-3 cells and identification of SNHG12 expression. A: CCK-8 assay for detecting cell viability. B: RT-qPCR for detecting expression of SNHG12 in PC-3 and PC-3R cells. n=3, ***P<0.001 vs PC-3 group.

Fig.2 Knockdown of SNHG12 inhibits docetaxel resistance in prostate cancer cells. A: Transfection efficiency of sh-SNHG12 detected by RT-qPCR. B: CCK-8 assay for assessing cell viability. C: Clone formation assay for assessing cell clone formation ability. D: Transwell assay for assessing cell migration ability (Scale bar=100 μm). n=3, **P<0.001, ***P<0.001 vs NC group; ###P<0.001 vs DTX group.

Fig.3 Knockdown of SNHG12 inhibits docetaxel resistance in prostate cancer cells through the PI3K/AKT signaling pathway. A: Western blotting for detecting expressions of p-PI3K/PI3K and p-AKT/AKT in PC-3 and PC-3R cells. B: CCK-8 assay for assessing viability of PC-3R cells. C: Clone formation assay for assessing clone formation ability of PC-3R cells. D: Transwell assay for assessing migration ability of PC-3R cells (Scale bar=100 μm). n=3, ***P<0.001 vs PC-3 group/DTX group; ##P<0.01, ###P<0.001 vs DTX+sh-SNHG12 group.

Fig.4 SNHG12 interacts with ELAVL1 to activate the PI3K/AKT signaling pathway. A: Immunofluorescence staining for detecting ELAVL1 expression in PC-3 and PC-3R cells (Scale bar=10 μm). B: RIP-qPCR for detecting enrichment level of SNHG12 on ELAVL1 in PC-3 and PC-3R cells. C: RT-qPCR for detecting transfection efficiency of sh-ELAVL1. D: Western blotting for detecting expressions of p-PI3K/PI3K and p-AKT/AKT in PC-3R cells. n=3, **P<0.01, ***P<0.001 vs PC-3 group/IgG group/NC group.

Fig.5 Knockdown of SNHG12 inhibits docetaxel resistance in prostate cancer. A: Gross observation of the dissected tumors from the nude mouse models. B: Tumor volume changes in each group. C: Tumor weight changes in each group. D: Immunohistochemical detection of Ki67 expression in the tumor tissues in each group (Scale bar=25 μm). E: Western blotting for detecting expressions of p-PI3K/PI3K and p-AKT/AKT in the tumor tissues. n=5, *P<0.05, ***P<0.001 vs NC group; ###P<0.001 vs DTX group.

References 33

[1]	Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-63. doi：10.3322/caac.21834
[2]	Chen HT, Pang BR, Zhou C, et al. Prostate cancer-derived small extracellular vesicle proteins: the hope in diagnosis, prognosis, and therapeutics[J]. J Nanobiotechnology, 2023, 21(1): 480. doi：10.1186/s12951-023-02219-0
[3]	Graham LS, Lin JK, Lage DE, et al. Management of prostate cancer in older adults[J]. Am Soc Clin Oncol Educ Book, 2023, 43: e390396. doi：10.1200/edbk_390396
[4]	Sun XC, Zhang Y, Xin SY, et al. NOTCH₃ promotes docetaxel resistance of prostate cancer cells through regulating TUBB3 and MAPK signaling pathway[J]. Cancer Sci, 2024, 115(2): 412-26. doi：10.1111/cas.16040
[5]	Lu JH, Zou QR, Li Y, et al. FTH1P8 induces and transmits docetaxel resistance by inhibiting ferroptosis in prostate cancer[J]. Biomed Pharmacother, 2024, 180: 117472. doi：10.1016/j.biopha.2024.117472
[6]	Hashemi M, Zandieh MA, Talebi Y, et al. Paclitaxel and docetaxel resistance in prostate cancer: Molecular mechanisms and possible therapeutic strategies[J]. Biomed Pharmacother, 2023, 160: 114392. doi：10.1016/j.biopha.2023.114392
[7]	Zhang YG. LncRNA-encoded peptides in cancer[J]. J Hematol Oncol, 2024, 17(1): 66. doi：10.1186/s13045-024-01591-0
[8]	Tamang S, Acharya V, Roy D, et al. SNHG12: an LncRNA as a potential therapeutic target and biomarker for human cancer[J]. Front Oncol, 2019, 9: 901. doi：10.3389/fonc.2019.00901
[9]	Cheng G, Song ZS, Liu YN, et al. Long noncoding RNA SNHG12 indicates the prognosis of prostate cancer and accelerates tumorigenesis via sponging miR-133b[J]. J Cell Physiol, 2020, 235(2): 1235-46. doi：10.1002/jcp.29039
[10]	Song JN, Wu XH, Ma R, et al. Long noncoding RNA SNHG12 promotes cell proliferation and activates Wnt/β-catenin signaling in prostate cancer through sponging microRNA-195[J]. J Cell Biochem, 2019, 120(8): 13066-75. doi：10.1002/jcb.28578
[11]	Li KY, Wang Q, Tang XY, et al. Advances in prostate cancer biomarkers and probes[J]. Cyborg Bionic Syst, 2024, 5: 0129. doi：10.34133/cbsystems.0129
[12]	Wang P, Chen D, Ma HB, et al. LncRNA SNHG12 contributes to multidrug resistance through activating the MAPK/Slug pathway by sponging miR-181a in non-small cell lung cancer[J]. Oncotarget, 2017, 8(48): 84086-101. doi：10.18632/oncotarget.20475
[13]	Lebedeva S, Jens M, Theil K, et al. Transcriptome-wide analysis of regulatory interactions of the RNA-binding protein HuR[J]. Mol Cell, 2011, 43(3): 340-52. doi：10.1016/j.molcel.2011.06.008
[14]	Ma S, Xu YH, Qin XY, et al. RUNX1, FUS, and ELAVL1-induced circPTPN22 promote gastric cancer cell proliferation, migration, and invasion through miR-6788-5p/PAK1 axis-mediated autophagy[J]. Cell Mol Biol Lett, 2024, 29(1): 95. doi：10.1186/s11658-024-00610-9
[15]	Kanzaki H, Chiba T, Kaneko T, et al. The RNA-binding protein ELAVL1 regulates hepatitis B virus replication and growth of hepatocellular carcinoma cells[J]. Int J Mol Sci, 2022, 23(14): 7878. doi：10.3390/ijms23147878
[16]	Mao GX, Mu ZM, Wu DA. Exosomal lncRNA FOXD3-AS1 upregulates ELAVL1 expression and activates PI3K/Akt pathway to enhance lung cancer cell proliferation, invasion, and 5-fluorouracil resistance[J]. Acta Biochim Biophys Sin (Shanghai), 2021, 53(11): 1484-94. doi：10.1093/abbs/gmab129
[17]	Cai ZL, Xu H, Bai G, et al. ELAVL1 promotes prostate cancer progression by interacting with other m6A regulators[J]. Front Oncol, 2022, 12: 939784. doi：10.3389/fonc.2022.939784
[18]	Wei LJ, Zhang Q, Zhong CC, et al. Functional inhibition of the RNA-binding protein HuR sensitizes triple-negative breast cancer to chemotherapy[J]. Mol Oncol, 2023, 17(10): 1962-80. doi：10.1002/1878-0261.13478
[19]	Huang YS, Xia L, Tan XW, et al. Molecular mechanism of lncRNA SNHG12 in immune escape of non-small cell lung cancer through the HuR/PD-L1/USP8 axis[J]. Cell Mol Biol Lett, 2022, 27(1): 43. doi：10.1186/s11658-022-00343-7
[20]	Li MX, Che N, Liu XZ, et al. Dauricine regulates prostate cancer progression by inhibiting PI3K/AKT-dependent M2 polarization of macrophages[J]. Biochem Pharmacol, 2023, 217: 115838. doi：10.1016/j.bcp.2023.115838
[21]	Eberlein C, Williamson SC, Hopcroft L, et al. Capivasertib combines with docetaxel to enhance anti-tumour activity through inhibition of AKT-mediated survival mechanisms in prostate cancer[J]. Br J Cancer, 2024, 130(8): 1377-87. doi：10.1038/s41416-024-02614-w
[22]	Lu XX, Yang FY, Chen DX, et al. Quercetin reverses docetaxel resistance in prostate cancer via androgen receptor and PI3K/Akt signaling pathways[J]. Int J Biol Sci, 2020, 16(7): 1121-34. doi：10.7150/ijbs.41686
[23]	Brady SN, Maggi LB Jr, Winkeler CL, et al. Nucleophosmin protein expression level, but not threonine 198 phosphorylation, is essential in growth and proliferation[J]. Oncogene, 2009, 28(36): 3209-20. doi：10.1038/onc.2009.178
[24]	Shi Q, Zhu YS, Ma J, et al. Prostate Cancer-associated SPOP mutations enhance cancer cell survival and docetaxel resistance by upregulating Caprin1-dependent stress granule assembly[J]. Mol Cancer, 2019, 18(1): 170. doi：10.1186/s12943-019-1096-x
[25]	Sun D, Fan XH. LncRNA SNHG12 accelerates the progression of ovarian cancer via absorbing miRNA-129 to upregulate SOX4[J]. Eur Rev Med Pharmacol Sci, 2019, 23(6): 2345-52.
[26]	Wang JZ, Xu CL, Wu H, et al. LncRNA SNHG12 promotes cell growth and inhibits cell apoptosis in colorectal cancer cells[J]. Braz J Med Biol Res, 2017, 50(3): e6079. doi：10.1590/1414-431x20176079
[27]	Peng Y, Wang YY, Zhou C, et al. PI3K/Akt/mTOR pathway and its role in cancer therapeutics: are we making headway?[J]. Front Oncol, 2022, 12: 819128. doi：10.3389/fonc.2022.819128
[28]	Li HY, Shen X, Ma MJ, et al. ZIP10 drives osteosarcoma proliferation and chemoresistance through ITGA10-mediated activation of the PI3K/AKT pathway[J]. J Exp Clin Cancer Res, 2021, 40(1): 340. doi：10.1186/s13046-021-02146-8
[29]	Okuno K, Xu CM, Pascual-Sabater S, et al. Berberine overcomes gemcitabine-associated chemoresistance through regulation of Rap1/PI3K-Akt signaling in pancreatic ductal adenocarcinoma[J]. Pharmaceuticals (Basel), 2022, 15(10): 1199. doi：10.3390/ph15101199
[30]	Yin HL, Qin HX, Yang L, et al. circCYP24A1 promotes Docetaxel resistance in prostate Cancer by Upregulating ALDH1A3[J]. Biomark Res, 2022, 10(1): 48. doi：10.1186/s40364-022-00393-1
[31]	Li YZ, Guo SQ, Liu WC, et al. Silencing of SNHG12 enhanced the effectiveness of MSCs in alleviating ischemia/reperfusion injuries via the PI3K/AKT/mTOR signaling pathway[J]. Front Neurosci, 2019, 13: 645. doi：10.3389/fnins.2019.00645
[32]	Cai ZL, Zhai XX, Xu JD, et al. ELAVL1 regulates PD-L1 mRNA stability to disrupt the infiltration of CD4-positive T cells in prostate cancer[J]. Neoplasia, 2024, 57: 101049. doi：10.1016/j.neo.2024.101049
[33]	Wei LJ, Kim SH, Armaly AM, et al. RNA-binding protein HuR inhibition induces multiple programmed cell death in breast and prostate cancer[J]. Cell Commun Signal, 2024, 22(1): 580. doi：10.1186/s12964-024-01916-z