Predictive value of NUF2 for prognosis and immunotherapy responses in pan-cancer

doi:10.12122/j.issn.1673-4254.2025.01.17

Abstract

Abstract:

Objective To investigate the association of NUF2 expression with tumor prognosis and its regulatory role in tumor microenvironment. Methods We analyzed NUF2 expression, its prognostic value, and is immune-related functions across different cancer types using datasets from the Human Protein Atlas (HPA), TCGA, GTEx, CCLE, and TIMER. RT-qPCR, Western blotting, and immunohistochemistry were used to detect NUF2 expression in liver cancer cell lines and tissue and blood samples from patients with liver cancer. GO, KEGG, and GSEA analyses were conducted to explore the molecular mechanisms of NUF2 and its related genes, and a competitive endogenous RNA (ceRNA) network for NUF2 in liver cancer was constructed. Results NUF2 expression was upregulated in the tumor tissues of 27 cancers and was associated with clinical stages in several cancers. High NUF2 expressions were correlated with poor overall survival, disease-specific survival, progression-free survival, and disease-free survival of cancer patients. NUF2 expression levels were positively correlated with tumor mutational burden, microsatellite instability, infiltrating immune cells, immune cell marker genes and immune checkpoint genes in different cancers. RT-qPCR, Western blotting, and immunohistochemistry confirmed that NUF2 expression was upregulated in liver cancer cell lines and tumor tissues and blood samples of liver cancer patients, and was decreased significantly after operation. GO, KEGG and GSEA analyses indicated that NUF2 was involved in chromosome segregation and cell cycle and was associated with glycine, serine and threonine metabolism. Conclusion NUF2 expression is upregulated in 27 cancers and is associated with clinical stage and poor prognosis in some malignancies. NUF2 expression is closely correlated with immune cell infiltration in different cancers, suggesting its potential value for predicting immunotherapy response in these cancers.

Key words: NUF2, pan-cancer analysis, immune infiltration, prognosis

Yaobin WANG, Liuyan CHEN, Yiling LUO, Jiqing SHEN, Sufang ZHOU. Predictive value of NUF2 for prognosis and immunotherapy responses in pan-cancer[J]. Journal of Southern Medical University, 2025, 45(1): 137-149.

Figures/Tables 10

Tab.1 Primer sequence for qRT-PCR

Gene	Primer sequence 5'-3'
NUF2	F: AGTTAAACGCCGCACACCAG
NUF2	R: CCCTCTTGCAGCACTATCGTT
ACTIN	F: CCAACCGCGAGAAGATGACC
ACTIN	R: GAGTCCATCACGATGCCAGT

Fig.1 Expression of NUF2 in pan-cancer and in different clinical stages. A: NUF2 mRNA expression levels in different human organs based on data from The Human Protein Atlas (www.proteinatlas.org). B: NUF2 expression in different cancers in TCGA and GTEx databases. C: NUF2 mRNA expressions in different cell lines based on CCLE database. D: Association between NUF2 expression and tumor stage. *P<0.05, **P<0.01, ***P<0.001.

Fig.2 Association of NUF2 expression with overall survival (OS) of cancer patients. A: Forest map of univariate Cox regression analysis of NUF2 in TCGA pan-cancer samples. B-K: Kaplan-Meier analysis of the association between NUF2 expression and OS.

Fig.3 Association of NUF2 expression level with disease-free survival of cancer patients. A: Forest map of univariate Cox regression analysis of NUF2 in TCGA pan-cancer samples. B-H: Kaplan-Meier analysis of the association between NUF2 expression and DFS.

Fig.4 Association of NUF2 expression with disease-specific survival (DSS) of cancer patients. A: Forest map of univariate Cox regression analysis of NUF2 in TCGA pan-cancer samples. B-K: Kaplan-Meier analysis of the association between NUF2 expression and DSS.

Fig.5 Association of NUF2 expression with progression-free survival (PFS) of cancer patients. A: Forest map of univariate Cox regression analysis of NUF2 in TCGA pan-cancer samples. B-N: Kaplan-Meier analysis of the association between NUF2 expression and PFS.

Fig.6 Association of NUF2 expression with tumor mutation burden (TMB) and microsatellite instability (MSI). A: TMB. B: MSI. *P<0.05, **P<0.01, ***P<0.001 by Spearman correlation test.

Fig.7 Correlation of NUF2 with pan-cancer immune cell infiltration and immune-related genes. A, B: Correlations of NUF2 expression with infiltration levels of various immune cells based on TIMER (A) and CIBERSORT (B) algorithms. C: Correlations of NUF2 with expressions of immune cell marker genes. D: Correlations of NUF2 with expressions of immune checkpoints-related genes. Statistical correlations were assessed using Spearman correlation test.

Fig.8 NUF2 expression in HCC cell lines and tissue and blood samples from HCC patients. A, B: Levels of NUF2 in LO2 and HepG2 cells detected by RT-qPCR and Western blotting. C: Expression of NUF2 in HCC tissues detected by immunohistochemistry (n=10). D: Expression of NUF2 in HCC patients (n=29) and healthy individuals (n=15). E: Expression of NUF2 before and after surgical treatment in patients with HCC (n=14). Wilcoxon test was used to examine the significance of variations between two sets of data. *P<0.05, **P<0.01, ****P<0.0001.

Fig.9 Molecular function of NUF2 and prediction of ceRNA regulatory patterns in HCC. A: Protein-protein interaction network of NUF2 based on the STRING database. B: GO and KEGG functional enrichment of NUF2-related genes. C: KEGG pathway analysis of NUF2 in GSEA in LIHC. D: miRNAs targeting NUF2 in HCC. E: Correlation analysis between hsa-miR-22-3p expression and NUF2 expression. F: Potential ceRNA regulatory axis of NUF2 in HCC. The red nodes indicate NUF2, the green nodes indicate miRNA, and the purple nodes indicate lncRNA. Statistical correlations were assessed using Spearman correlation test.

References 35

1	Bray F, Laversanne M, Weiderpass E, et al. The ever-increasing importance of cancer as a leading cause of premature death worldwide[J]. Cancer, 2021, 127(16): 3029-30.
2	Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-63.
3	Srivastava S, Hanash S. Pan-cancer early detection: hype or hope?[J]. Cancer Cell, 2020, 38(1): 23-4.
4	Law HKW, Yim HCH. Early diagnosis of cancer using circulating microbial DNA[J]. Cell Rep Med, 2024, 5(4): 101502.
5	Kennedy LB, Salama AKS. A review of cancer immunotherapy toxicity[J]. CA Cancer J Clin, 2020, 70(2): 86-104.
6	Singh AK, McGuirk JP. CAR T cells: continuation in a revolution of immunotherapy[J]. Lancet Oncol, 2020, 21(3): e168-e178.
7	Hijazi A, Antoniotti C, Cremolini C, et al. Light on life: immunoscore immune-checkpoint, a predictor of immunotherapy response[J]. Oncoimmunology, 2023, 12(1): 2243169.
8	Foley EA, Kapoor TM. Microtubule attachment and spindle assembly checkpoint signalling at the kinetochore[J]. Nat Rev Mol Cell Biol, 2013, 14(1): 25-37.
9	Cheerambathur DK, Gassmann R, Cook B, et al. Crosstalk between microtubule attachment complexes ensures accurate chromosome segregation[J]. Science, 2013, 342(6163): 1239-42.
10	Lin JT, Chen XL, Yu HJ, et al. NUF2 drives clear cell renal cell carcinoma by activating HMGA2 transcription through KDM2A-mediated H3K36me2 demethylation[J]. Int J Biol Sci, 2022, 18(9): 3621-35.
11	Leng RB, Meng YF, Sun XM, et al. NUF2 overexpression contributes to epithelial ovarian cancer progression via ERBB3-mediated PI3K-AKT and MAPK signaling axes[J]. Front Oncol, 2022, 12: 1057198.
12	Shan JJ, Jiang WJ, Chang J, et al. NUF2 drives cholangiocarcinoma progression and migration via inhibiting autophagic degradation of TFR1[J]. Int J Biol Sci, 2023, 19(5): 1336-51.
13	Li TW, Fu JX, Zeng ZX, et al. TIMER2.0 for analysis of tumor-infiltrating immune cells[J]. Nucleic Acids Res, 2020, 48(W1): W509-W514.
14	Lv SM, Xu WJ, Zhang YY, et al. NUF2 as an anticancer therapeutic target and prognostic factor in breast cancer[J]. Int J Oncol, 2020, 57(6): 1358-67.
15	Deng Y, Li JP, Zhang YJ, et al. NUF2 promotes breast cancer development as a new tumor stem cell indicator[J]. Int J Mol Sci, 2023, 24(4): 4226.
16	Ren M, Zhao HY, Gao Y, et al. NUF2 promotes tumorigenesis by interacting with HNRNPA2B1 via PI3K/AKT/mTOR pathway in ovarian cancer[J]. J Ovarian Res, 2023, 16(1): 17.
17	Zhu XW, Zou YM, Wu T, et al. ANP32E contributes to gastric cancer progression via NUF2 upregulation[J]. Mol Med Rep, 2022, 26(3): 275.
18	Jiang F, Huang XL, Yang X, et al. NUF2 expression promotes lung adenocarcinoma progression and is associated with poor prognosis[J]. Front Oncol, 2022, 12: 795971.
19	Fu HL, Shao L. Silencing of NUF2 inhibits proliferation of human osteosarcoma Saos-2 cells[J]. Eur Rev Med Pharmacol Sci, 2016, 20(6): 1071-9.
20	Huang SK, Qian JX, Yuan BQ, et al. SiRNA-mediated knockdown against NUF2 suppresses tumor growth and induces cell apoptosis in human glioma cells[J]. Cell Mol Biol, 2014, 60(4): 30-6.
21	Liu YW, Wang YM, Wang JF, et al. NUF2 regulated the progression of hepatocellular carcinoma through modulating the PI3K/AKT pathway via stabilizing ERBB3[J]. Transl Oncol, 2024, 44: 101933.
22	Sugimasa H, Taniue K, Kurimoto A, et al. Heterogeneous nuclear ribonucleoprotein K upregulates the kinetochore complex component NUF2 and promotes the tumorigenicity of colon cancer cells[J]. Biochem Biophys Res Commun, 2015, 459(1): 29-35.
23	Galon J, Costes A, Sanchez-Cabo F, et al. Type, density, and location of immune cells within human colorectal tumors predict clinical outcome[J]. Science, 2006, 313(5795): 1960-4.
24	Fridman WH, Pagès F, Sautès-Fridman C, et al. The immune contexture in human tumours: impact on clinical outcome[J]. Nat Rev Cancer, 2012, 12(4): 298-306.
25	Remark R, Merghoub T, Grabe N, et al. In-depth tissue profiling using multiplexed immunohistochemical consecutive staining on single slide[J]. Sci Immunol, 2016, 1(1): aaf6925.
26	Cao YY, Jiao NL, Sun TT, et al. CXCL11 correlates with antitumor immunity and an improved prognosis in colon cancer[J]. Front Cell Dev Biol, 2021, 9: 646252.
27	Samstein RM, Lee CH, Shoushtari AN, et al. Tumor mutational load predicts survival after immunotherapy across multiple cancer types[J]. Nat Genet, 2019, 51(2): 202-6.
28	Rizvi NA, Hellmann MD, Snyder A, et al. Cancer immunology. Mutational landscape determines sensitivity to PD-1 blockade in non-small cell lung cancer[J]. Science, 2015, 348(6230): 124-8.
29	Chabanon RM, Pedrero M, Lefebvre C, et al. Mutational landscape and sensitivity to immune checkpoint blockers[J]. Clin Cancer Res, 2016, 22(17): 4309-21.
30	Chan TA, Wolchok JD, Snyder A. Genetic basis for clinical response to CTLA-4 blockade in melanoma[J]. N Engl J Med, 2015, 373(20): 1984.
31	Herbst RS, Soria JC, Kowanetz M, et al. Predictive correlates of response to the anti-PD-L1 antibody MPDL3280A in cancer patients[J]. Nature, 2014, 515(7528): 563-7.
32	Pawłowska A, Skiba W, Suszczyk D, et al. The dual blockade of the TIGIT and PD-1/PD-L1 pathway as a new hope for ovarian cancer patients[J]. Cancers, 2022, 14(23): 5757.
33	Ravi A, Hellmann MD, Arniella MB, et al. Genomic and transcriptomic analysis of checkpoint blockade response in advanced non-small cell lung cancer[J]. Nat Genet, 2023, 55(5): 807-19.
34	Hao DP, Liu J, Chen M, et al. Immunogenomic analyses of advanced serous ovarian cancer reveal immune score is a strong prognostic factor and an indicator of chemosensitivity[J]. Clin Cancer Res, 2018, 24(15): 3560-71.
35	Qu JJ, Li M, Zhong W, et al. Competing endogenous RNA in cancer: a new pattern of gene expression regulation[J]. Int J Clin Exp Med, 2015, 8(10): 17110-6.

[1]	Xiaorui CHEN, Qingzheng WEI, Zongliang ZHANG, Jiangshui YUAN, Weiqing SONG. Overexpression of CHMP2B suppresses proliferation of renal clear cell carcinoma cells [J]. Journal of Southern Medical University, 2025, 45(1): 126-136.
[2]	Xiaohua CHEN, Hui LU, Ziliang WANG, Lian WANG, Yongsheng XIA, Zhijun GENG, Xiaofeng ZHANG, Xue SONG, Yueyue WANG, Jing LI, Jianguo HU, Lugen ZUO. Role of Abelson interactor 2 in progression and prognosis of gastric cancer and its regulatory mechanisms [J]. Journal of Southern Medical University, 2024, 44(9): 1653-1661.
[3]	Mengnan YE, Hongmei WU, Yan MEI, Qingling ZHANG. High expression of CREM is associated with poor prognosis in gastric cancer patients [J]. Journal of Southern Medical University, 2024, 44(9): 1776-1782.
[4]	Kai JI, Guanyu YU, Leqi ZHOU, Tianshuai ZHANG, Qianlong LING, Wenjiang MAN, Bing ZHU, Wei ZHANG. HNRNPA1 gene is highly expressed in colorectal cancer: its prognostic implications and potential as a therapeutic target [J]. Journal of Southern Medical University, 2024, 44(9): 1685-1695.
[5]	Jingjing YANG, Lixia YIN, Ting DUAN, Minzhu NIU, Zhendong HE, Xinrui CHEN, Xiaofeng ZHANG, Jing LI, Zhijun GENG, Lugen ZUO. High expression of ATP5A1 in gastric carcinoma is correlated with a poor prognosis and enhanced glucose metabolism in tumor cells [J]. Journal of Southern Medical University, 2024, 44(5): 974-980.
[6]	Qinzhi WANG, Bing SONG, Shirui HAO, Zhiyuan XIAO, Lianhui JIN, Tong ZHENG, Fang CHAI. Bioinformatic analysis of CCND2 expression in papillary thyroid carcinoma and its impact on immune infiltration [J]. Journal of Southern Medical University, 2024, 44(5): 981-988.
[7]	SHEN Mengdi, ZHAO Na, DENG Xiaojing, DENG Min. High expression of COX6B2 in gastric cancer is associated with poor long-term prognosis and promotes cell proliferation and cell cycle progression by inhibiting p53 signaling [J]. Journal of Southern Medical University, 2024, 44(2): 289-297.
[8]	ZHANG Nuo, ZHANG Zhen, ZHANG Yulu, SONG Xue, ZHANG Xiaofeng, LI Jing, ZUO Lugen, HU Jianguo. PCID2 is highly expressed in gastric cancer and affects the prognosis by regulating cancer cell cycle and proliferation [J]. Journal of Southern Medical University, 2024, 44(2): 324-332.
[9]	ZHANG Wenjing, ZHANG Nuo, YANG Zi, ZHANG Xiaofeng, SUN Aofei, WANG Lian, SONG Xue, GENG Zhijun, LI Jing, HU Jianguo. Overexpression of BZW1 promotes invasion and metastasis of gastric cancer cells by regulating Wnt/β-catenin signaling and promoting epithelial-mesenchymal transition [J]. Journal of Southern Medical University, 2024, 44(2): 354-362.
[10]	Fuxing ZHANG, Guoqing LIU, Rui DONG, Lei GAO, Weichen LU, Lianxia GAO, Zhongkuo ZHAO, Fei LU, Mulin LIU. High expression of CRTAC1 promotes proliferation, migration and immune cell infiltration of gastric cancer by regulating the PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2024, 44(12): 2421-2433.
[11]	Ruxue TAN, Xiaozhang BAO, Liang HAN, Zhaohui LI, Nan TIAN. A two-site combined prediction model based on HOXA9 DNA methylation for early screening of risks of meningioma progression [J]. Journal of Southern Medical University, 2024, 44(11): 2110-2120.
[12]	Zhen ZHANG, Hui LU, Xiaohua CHEN, Lian WANG, Ziliang WANG, Yueyue WANG, Sitang GE, Lugen ZUO. CEP192 overexpression is correlated with poor prognosis of gastric cancer and promotes gastric cancer cell proliferation by regulating PLK1/CDK1/Cyclin B1 signaling [J]. Journal of Southern Medical University, 2024, 44(11): 2137-2145.
[13]	DUAN Ting, ZHANG Zhen, SHI Jinran, XIAO Linyu, YANG Jingjing, YIN Lixia, ZHANG Xiaofeng, GENG Zhijun, LU Guoyu. High expression of CPNE3 correlates with poor long-term prognosis of gastric cancer by inhibiting cell apoptosis via activating PI3K/AKT signaling [J]. Journal of Southern Medical University, 2024, 44(1): 129-137.
[14]	YAO Yina, LIU Jia, ZHOU Xiangjun, LIU Zeyu, QIU Shizhen, HE Yingzheng, ZHOU Xueqiong. A pan-cancer analysis of TTC9A expression level and its correlation with prognosis and immune microenvironment [J]. Journal of Southern Medical University, 2024, 44(1): 70-82.
[15]	WANG Lian, XIA Yongsheng, ZHANG Zhen, LIU Xinyue, SHI Jinran, WANG Yueyue, LI Jing, ZHNAG Xiaofeng, GENG Zhijun, SONG Xue, ZUO Lugen. High expression of MRPL13 promotes cell cycle progression and proliferation of gastric cancer cells by inhibiting p53 signaling to affect long-term prognosis [J]. Journal of Southern Medical University, 2023, 43(9): 1558-1566.