Kahweol improves motor function of mice with spinal cord injury by inhibiting microglial activation via regulating the IκBα/NF-κB pathway

doi:10.12122/j.issn.1673-4254.2025.12.04

Abstract

Abstract:

Objective To investigate the mechanism of kahweol for promoting motor function recovery in mice with spinal cord injury (SCI). Methods Fifty-four 8- to 10- week-old C57BL/6J mice were randomized equally into sham operation (laminectomy only) group, SCI group (laminectomy with spinal cord contusion), and Kahweol treatment group (with daily intraperitoneal injection of 20 mg/kg Kahweol following SCI). Motor function of the mice was evaluated using BMS scores, footprint analysis, and swimming test, and SCI area, myelin integrity, and neuron survival were assessed using HE, LFB, and Nissl staining. In a co-culture system of lipopolysaccharide (LPS)‑stimulated BV2 cells and HT22 neurons, the effects of different concentrations of Kahweol and PMA, a NF-κB pathway activator, on the number of activated microglia and apoptotic neurons were evaluated with immunofluorescence staining, and the changes in apoptosis-related proteins and IκBα/NF‑κB pathway proteins were detected using Western blotting. The levels of inflammatory factors (TNF-α, IL-6, and IL-1β) were measured by qRT-PCR and ELISA. Results In the mice with SCI, kahweol treatment significantly promoted motor function recovery, reduced injury area in the spinal cord tissue, and increased the myelinated area and number of neurons. In both the mouse models and the cell co-culture system, kahweol treatment effectively alleviated neuronal apoptosis by inhibiting microglial activation and reducing the release of inflammatory factors. The results of Western blotting showed that kahweol significantly decreased the phosphorylation levels of NF‑κB and IκBα. In the cell co-culture system, PMA obviously attenuated the inhibitory effect of kahweol on BV2 cell activation and neuronal apoptosis. Conclusion Kahweol promotes motor function recovery of mice with SCI by suppressing microglial activation via inhibiting the NF‑κB pathway, which shed light on a new strategy for clinical treatment of SCI.

Key words: spinal cord injury, kahweol, microglia, neuronal apoptosis, nuclear factor-κB

Jinzhi XIA, Yue CHEN, Lü REN, Jing LI, Xue SONG, Lu TAO, Jianguo HU. Kahweol improves motor function of mice with spinal cord injury by inhibiting microglial activation via regulating the IκBα/NF-κB pathway[J]. Journal of Southern Medical University, 2025, 45(12): 2561-2572.

Figures/Tables 9

Tab.1 Primer sequences (5' to 3') for RT-qPCR

Gene (mice)	Forward primer	Reverse primer
GAPDH	TGGCCTTCCGTGTTCCTAC	GAGTTGCTGTTGAAGTCGCA
TNF-α	CAGGCGGTGCCTATGTCTC	CGATCACCCCGAAGTTCAGTAG
IL-6	TCTATACCACTTCACAAGTCGGA	GAATTGCCATTGCACAACTCTTT
IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG-

Fig.1 Kahweol (Kah) improves motor function and alleviates spinal cord tissue pathologies of SCI mice. A: BMS Score. B, C: Footprint score. D, E: Swimming experiments. F: Dorsal view of fresh spinal cords on days 7. G: HE staining. H: Quantitative analysis of the lesion areas in the 3 groups. I: LFB staining. J: Quantitative analysis of residual myelination in the 3 groups. K: Nissl staining. L: Quantitative analysis of the number of motor neurons in the 3 groups. n=5 in each group. *P<0.05, **P<0.01.

Fig.2 Kah attenuates neuronal apoptosis in the spinal cord of SCI mice. A: Immunofluorescent staining for NeuN and cleaved caspase3. B: Quantification analysis of the number of NeuN+ cleaved caspase3+ cells. C-F: Western blotting and quantitative analysis of protein expression levels. n=3 in each group. *P<0.05, **P<0.01.

Fig. 3 Kah reduces the expressions of inflammation-related factors and inhibits microglial activation in the spinal cord of SCI mice. A: Immunofluorescent staining for CD11b and CD68. B: Quantification analysis of the number of the CD11b+ CD68+ cells. C-E: Effect of Kah on mRNA levels of TNF‑α, IL-6 and IL-1β. F-H: Quantification of protein levels of TNF-α, IL-6 and IL-1β. n=3 in each group. **P<0.01.

Fig. 4 The protective effect of Kah in SCI mice may be related to the NF-κB signaling pathway. A-C: Proteins expressions of NF-κB, p-NF-κB, IκBα and p-IκBα in the spinal cord of SCI mice detected by Western blotting and quantitative analysis of protein levels. n=3 in each group. *P<0.05.

Fig.5 Kah inhibits LPS-induced microglial activation and expressions of inflammatory cytokines. A: Immunofluorescent staining for CD11b and CD68. B: Quantification analysis of the number of the CD11b+ CD68+ cells. C-E: Effect of Kah on mRNA levels of TNF‑α, IL-6 and IL-1β. F-H: Quantification of protein levels of TNF-α, IL-6 and IL-1β. n=3 in each group. *P<0.05, **P<0.001.

Fig.6 Kah attenuates neuronal apoptosis caused by microglial activation. A: Immunofluorescent staining for NeuN and cleaved caspase-3. B: Quantification analysis of the number of the NeuN+/cleaved caspase-3+ cells. C-F: Western blotting analysis and quantitative analysis of protein expression levels. n=3 in each group. *P<0.05, **P<0.001.

Fig.7 Kah inhibits the NF-kB signaling pathway. A-C: Proteins expressions of NF-κB, p-NF-κB, IκBα and p-IκBα in BV2 cells detected by Western blotting and quantitative analysis of protein levels. n=3 in each group. *P<0.05, **P<0.001.

Fig.8 Kah attenuates microglial activation and neuronal apoptosis by inhibiting the NF-κB pathway. A: Immunofluorescent staining for CD11b and CD68. B: Quantification analysis of the number of CD11b+CD68+ cells. C: Immunofluorescent staining for NeuN and cleaved caspase3. D: Quantification analysis of the number of the NeuN+ cleaved caspase3+ cells. E, F: Western blotting and quantitative analysis of protein expression levels. n=3 in each group. *P<0.05, **P<0.001.

References 34

[1]	Martynyuk T, Ricard J, Bracchi-Ricard V, et al. Mitigating sTNF/TNFR1 activation on VGluT2+spinal cord interneurons improves immune function after mid-thoracic spinal cord injury[J]. Brain Behav Immun, 2025, 123: 633-43. doi：10.1016/j.bbi.2024.10.021
[2]	Anjum A, Yazid MD, Fauzi Daud M, et al. Spinal cord injury: pathophysiology, multimolecular interactions, and underlying recovery mechanisms[J]. Int J Mol Sci, 2020, 21(20): E7533. doi：10.3390/ijms21207533
[3]	Ma H, Wang C, Han L, et al. Tofacitinib promotes functional recovery after spinal cord injury by regulating microglial polarization via JAK/STAT signaling pathway[J]. Int J Biol Sci, 2023, 19(15): 4865-82. doi：10.7150/ijbs.84564
[4]	Kunnumakkara AB, Shabnam B, Girisa S, et al. Inflammation, NF-κB, and chronic diseases: how are they linked?[J]. Crit Rev Immunol, 2020, 40(1): 1-39. doi：10.1615/critrevimmunol.2020033210
[5]	Zhao HS, Mei XF, Yang DF, et al. Resveratrol inhibits inflammation after spinal cord injury via SIRT-1/NF-κB signaling pathway[J]. Neurosci Lett, 2021, 762: 136151. doi：10.1016/j.neulet.2021.136151
[6]	Song C, Zhang K, Luo C, et al. Inhibiting the NF-κB/DRP1 axis affords neuroprotection after spinal cord injury via inhibiting polarization of pro-inflammatory microglia[J]. Front Biosci: Landmark Ed, 2024, 29(8): 307. doi：10.31083/j.fbl2908307
[7]	Fei M, Li Z, Cao YW, et al. microRNA-182 improves spinal cord injury in mice by modulating apoptosis and the inflammatory response via IKKβ/NF-κB[J]. Lab Investig, 2021, 101(9): 1238-53. doi：10.1038/s41374-021-00606-5
[8]	Wang H, Lin F, Wu Y, et al. Carrier-free nanodrug based on co-assembly of methylprednisolone dimer and rutin for combined treatment of spinal cord injury[J]. ACS Nano, 2023, 17(13): 12176-87. doi：10.1021/acsnano.3c00360
[9]	Baroudi M, Rezk A, Daher M, et al. Management of traumatic spinal cord injury: a current concepts review of contemporary and future treatment[J]. Injury, 2024, 55(6): 111472. doi：10.1016/j.injury.2024.111472
[10]	Socała K, Szopa A, Serefko A, et al. Neuroprotective effects of coffee bioactive compounds: a review[J]. Int J Mol Sci, 2020, 22(1): E107. doi：10.3390/ijms22010107
[11]	Eldesouki S, Qadri R, Abu Helwa R, et al. Recent updates on the functional impact of kahweol and cafestol on cancer[J]. Molecules, 2022, 27(21): 7332. doi：10.3390/molecules27217332
[12]	Seo HY, Kim MK, Lee SH, et al. Kahweol ameliorates the liver inflammation through the inhibition of NF-κB and STAT3 activation in primary kupffer cells and primary hepatocytes[J]. Nutrients, 2018, 10(7): E863. doi：10.3390/nu10070863
[13]	Lee HF, Lin JS, Chang CF. Acute kahweol treatment attenuates traumatic brain injury neuroinflammation and functional deficits[J]. Nutrients, 2019, 11(10): E2301. doi：10.3390/nu11102301
[14]	Hwang YP, Jeong HG. The coffee diterpene kahweol induces heme oxygenase-1 via the PI3K and p38/Nrf2 pathway to protect human dopaminergic neurons from 6-hydroxydopamine-derived oxidative stress[J]. FEBS Lett, 2008, 582(17): 2655-62. doi：10.1016/j.febslet.2008.06.045
[15]	Xue MT, Sheng WJ, Song X, et al. Atractylenolide III ameliorates spinal cord injury in rats by modulating microglial/macrophage polarization[J]. CNS Neurosci Ther, 2022, 28(7): 1059-71. doi：10.1111/cns.13839
[16]	Duan FX, Shi YJ, Chen J, et al. Neuroprotective effects of P7C3 against spinal cord injury in rats[J]. Exp Biol Med: Maywood, 2019, 244(18): 1680-7. doi：10.1177/1535370219888620
[17]	Kim JY, Leem J, Kim GM. Kahweol protects against acetaminophen-induced hepatotoxicity in mice through inhibiting oxidative stress, hepatocyte death, and inflammation[J]. Biomed Res Int, 2022, 2022: 8121124. doi：10.1155/2022/8121124
[18]	Kim JY, Jo J, Leem J, et al. Kahweol ameliorates cisplatin-induced acute kidney injury through pleiotropic effects in mice[J]. Biomedicines, 2020, 8(12): E572. doi：10.3390/biomedicines8120572
[19]	Basso DM, Fisher LC, Anderson AJ, et al. Basso Mouse Scale for locomotion detects differences in recovery after spinal cord injury in five common mouse strains[J]. J Neurotrauma, 2006, 23(5): 635-59. doi：10.1089/neu.2006.23.635
[20]	Xu YB, Geng ZJ, Sun Y, et al. Complanatuside A improves functional recovery after spinal cord injury through inhibiting JNK signaling-mediated microglial activation[J]. Eur J Pharmacol, 2024, 965: 176287. doi：10.1016/j.ejphar.2023.176287
[21]	Liu S, Wu Q, Wang LY, et al. Coordination function index: a novel indicator for assessing hindlimb locomotor recovery in spinal cord injury rats based on catwalk gait parameters[J]. Behav Brain Res, 2024, 459: 114765. doi：10.1016/j.bbr.2023.114765
[22]	Jiang D, Gong F, Ge X, et al. Neuron-derived exosomes-transmitted miR-124-3p protect traumatically injured spinal cord by suppressing the activation of neurotoxic microglia and astrocytes[J]. J Nanobiotechnology, 2020, 18(1): 105. doi：10.1186/s12951-020-00665-8
[23]	Lei P, Li Z, Hua Q, et al. Ursolic acid alleviates neuroinflammation after intracerebral hemorrhage by mediating microglial pyroptosis via the NF-κB/NLRP3/GSDMD pathway[J]. Int J Mol Sci, 2023, 24(19): 14771. doi：10.3390/ijms241914771
[24]	Zhang Y, Jia J. Betaine mitigates amyloid‑β‑associated neuroinfl-ammation by suppressing the NLRP3 and NF‑κB signaling pathways in microglial cells[J]. J Alzheimers Dis, 2023, 94(s1): S9-19. doi：10.3233/jad-230064
[25]	Shen T, Park YC, Kim SH, et al. Nuclear factor-kappaB/signal transducers and activators of transcription-1-mediated inflammatory responses in lipopolysaccharide-activated macrophages are a major inhibitory target of kahweol, a coffee diterpene[J]. Biol Pharm Bull, 2010, 33(7): 1159-64. doi：10.1248/bpb.33.1159
[26]	Li G, Fu T, Wang W, et al. Pretreatment with kahweol attenuates sepsis-induced acute lung injury via improving mitochondrial homeostasis in a CaMKKII/AMPK-dependent pathway[J]. Mol Nutr Food Res, 2023, 67(19): e2300083. doi：10.1002/mnfr.202300083
[27]	Liu H, Zhang J, Xu X, et al. SARM1 promotes neuroinflammation and inhibits neural regeneration after spinal cord injury through NF-κB signaling[J]. Theranostics, 2021, 11(9): 4187-206. doi：10.7150/thno.49054
[28]	Ryu Y, Ogata T, Nagao M, et al. The swimming test is effective for evaluating spasticity after contusive spinal cord injury[J]. PLoS One, 2017, 12(2): e0171937. doi：10.1371/journal.pone.0171937
[29]	Metz GAS, Merkler D, Dietz V, et al. Efficient testing of motor function in spinal cord injured rats[J]. Brain Res, 2000, 883(2): 165-77. doi：10.1016/s0006-8993(00)02778-5
[30]	Davidson LT, Evans MC. Congenital and acquired spinal cord injury and dysfunction[J]. Pediatr Clin North Am, 2023, 70(3): 461-81. doi：10.1016/j.pcl.2023.01.017
[31]	de Oliveira MR, de Souza ICC, Fürstenau CR. Mitochondrial protection promoted by the coffee diterpene kahweol in methylglyoxal-treated human neuroblastoma SH-SY5Y cells[J]. Neurotox Res, 2020, 37(1): 100-10. doi：10.1007/s12640-019-00107-w
[32]	Meng TY, Zhang YF, Huang J, et al. Rubusoside mitigates neuroinflammation and cellular apoptosis in Parkinson's disease, and alters gut microbiota and metabolite composition[J]. Phytomedicine, 2024, 124: 155309. doi：10.1016/j.phymed.2023.155309
[33]	Mitchell JP, Carmody RJ. Chapter two NF-κB and the transcriptional control of inflammation[J]. Int Rev Cell Mol Biol, 2018, 335: 41-84. doi：10.1016/bs.ircmb.2017.07.007
[34]	Wei J, Li T, Lin S, et al. Dihydrotestosterone reduces neuroinflammation in spinal cord injury through NF-κB and MAPK pathway[J]. Cell Mol Biol: Noisy-le-grand, 2024, 70(1): 213-8. doi：10.14715/cmb/2024.70.1.29