Butyrate alleviates Clostridium difficile infection in high-fat diet-induced obese mice

doi:10.12122/j.issn.1673-4254.2026.07.02

Abstract

Abstract:

Objective To investigate the mechanism by which obesity exacerbates Clostridium difficile infection (CDI) and explore the value of gut microbiota metabolite butyrate as an alternative therapy. Methods In mouse models of high-fat diet (HFD)-induced obesity and CDI and normal diet-fed mouse models of CDI, the effect of butyrate treatment on hepatic lipid deposition and liver function was assessed using Oil Red O staining and by measuring aspartate aminotransferase and alanine aminotransferase levels. Superoxide dismutase (SOD) activity and malondialdehyde (MDA) of the mice were determined, and colonic injury was evaluated using HE staining. The expression levels of intestinal mucosal barrier proteins ZO-1 and occludin were detected by RT-PCR and immunohistochemistry, and the levels of C. difficile toxins A and B in mouse serum and feces were measured using RT-PCR and ELISA. The concentration of short-chain fatty acids (SCFAs) in mouse feces was determined using gas chromatography-mass spectrometry. In HCT116 cells induced by palmitic acid in the presence or absence of C. difficile, the effect of butyrate expression levels of ZO-1 and occludin were examined by immunofluorescence staining, and cell apoptosis was analyzed with flow cytometry. Results Compared with normal diet-fed mice, the HFD-fed mice with CDI had a significantly higher mortality rate and exhibited severer colonic damage, intestinal barrier function impairment and liver injury with significantly reduced fecal SCFAs concentrations. Butyrate replacement therapy markedly alleviated CDI symptoms, improved intestinal barrier function, and reduced the levels of liver injury markers. Fecal microbiota transplantation produced similar effects to butyrate and obviously alleviated CDI symptoms and increased fecal SCFAs concentrations in the mouse models. Conclusion HFD significantly exacerbates the progression of CDI in mice, and butyrate shows the potential as an alternative therapy for improving obesity-associated CDI.

Key words: Clostridium difficile infection, obesity, butyrate, intestinal barrier, fecal microbiota transplantation

Minyu DONG, Zeyang FANG, Yunyun ZHANG, Youliang WU, Huangjie ZHENG, Yongjun LIU, Qiong YANG, Deqian KONG, Kequan CHEN, Siqi WANG. Butyrate alleviates Clostridium difficile infection in high-fat diet-induced obese mice[J]. Journal of Southern Medical University, 2026, 46(7): 1474-1486.

Figures/Tables 13

Tab.1 Primer sequences for RT-qPCR

Primer name	Sequences
Toxin A	Forward:GGACATGGTAAAGATGAATTC
	Reverse: CCCAATAGAAGATTCAATATTAAGCTT
Toxin B	Forward: TCTGATGCACTATGTGACTTA
	Reverse: ATCTACGAGCGTAGTCAC
GAPDH (Mouse)	Forward: GGAGAAACCTGCCAAGTATGA
	Reverse: TCCTCAGTGTAGCCCAAGA
ZO-1 (Mouse)	Forward: TGAACGTCCCTGACCTTTCG
	Reverse: CTGTGGAGACTGCGTGGAAT
Occludin (Mouse)	Forward: CTTTGGCTACGGAGGTGGCTAT
	Reverse: CTTTGGCTGCTCTTGGGTCTG

Fig.1 Mice fed with HFD exacerbate CDI compared with NCD. A: Schematic diagram of establishment of HFD+CDI and normal chow diet (NCD)+CDI mouse models. B: Appearance of the mice in the HFD and NCD groups. C: Changes in body weight after inoculation with Clostridioides difficile. D: HE staining of colon tissues. E: Survival rate after inoculation with Clostridioides difficile. F: Oil Red O staining of liver tissues. NCD: Normal Chow Diet, HFD: High-Fat Diet.

Fig. 2 Mice fed with HFD exacerbate CDI compared with NCD. A: Serum TcdA and TcdB levels. B: Feces TcdA and TcdB levels. C: Serum ALT and AST levels. D: Serum TG and TC concentrations. E: eWAT weight and liver weight. F: SOD activity and MDA levels. Data are presented as Mean±SD(n=6). **P<0.01 vs NCD.

Fig.3 HFD aggravates intestinal barrier function impairment in CID mice. A: Immunohistochemical staining of ZO-1 and occluding. B: RT-PCR results of ZO-1 and Occludin. C: Concentrations of short-chain fatty acids (SCFAs) in mice of the HFD and NCD groups. Data are presented as Mean±SD (n=6), *P<0.05, **P<0.01 vs NCD.

Fig.4 Butyrate treatment alleviates symptoms of CDI mice with HFD feeding. A: Schematic diagram of butyrate intervention in HFD+CDI mice. B: HE staining of colon tissues. C: Changes in body weight after inoculation with Clostridioides difficile. D: Survival rate after inoculation with Clostridioides difficile. E: Oil Red O staining of liver tissues. BT: Butyrate treatment.

Fig.5 Butyrate treatment alleviates symptoms of CDI mice with HFD feeding. A: Serum levels of TcdA and TcdB. B: Fecal levels TcdA and TcdB. C: Serum ALT and AST levels. D: Serum TG and TC concentrations. E: eWAT weight and liver weight. F: SOD activity and MDA levels. Data are presented as Mean±SD(n=6). *P<0.05, **P<0.01 vs HFD.

Fig.6 Butyrate improves intestinal barrier function impairment in HFD mice with CDI. A: Immunohistochemical staining results of intestinal barrier markers in colon tissues. B: Immunohistochemical analysis of Bax and Bcl-2. Data are presented as Mean±SD.*P<0.05, **P<0.01 vs HFD.

Fig.7 Butyrate improves intestinal barrier function impairment in HFD mice with CDI. A: RT-PCR results of intestinal barrier-related genes. B: RT-PCR results of apoptosis-related genes. C: SCFA concentrations in HFD+CDI mice after butyrate treatment. Data are presented as Mean±SD. *P<0.05, **P<0.01 vs HFD.

Fig.8 Butyrate alleviates palmitic acid-induced cell apoptosis. A: Immunofluorescence staining results of ZO-1. B: Immunofluorescence staining results of occludin. C: Flow cytometric analysis of cell apoptosis.

Fig.9 Fecal microbiota transplantation (FMT) ameliorates severity of CDI in HFD mice. A: Schematic diagram of FMT intervention experiment in HFD-CDI mice. B: HE staining of colon tissues. C: Changes in body weight after inoculation with Clostridioides difficile. D: Survival rate after inoculation with Clostridioides difficile. E: Oil Red O staining of liver tissues. FMT: Fecal microbiota transplantation.

Fig.10 Fecal microbiota transplantation (FMT) ameliorates severity of CDI in HFD mice. A: Serum levels of TcdA and TcdB. B: Feces levels of TcdA and TcdB. C: Serum ALT and AST levels. D: Serum TG and TC concentrations. E: eWAT weight and liver weight. F: SOD activity and MDA levels. Data are presented as Mean±SD, n=6. **P<0.01 vs HFD.

Fig.11 FMT ameliorates intestinal barrier function impairment in HFD mice with CDI. A: Immunohistochemical analysis of intestinal barrier markers in mouse colon tissues. B Immunohistochemical analysis of Bax and Bcl-2. Data are presented as Mean±SD(n=6). *P<0.05, **P<0.01 vs HFD.

Fig. 12 MT ameliorates intestinal barrier function impairment in HFD mice with CDI. A: RT-PCR results of intestinal barrier-related genes. B: RT-PCR results of apoptosis-related genes. C: SCFA concentrations in HFD+CDI mice after FMT treatment. Data are presented as Mean±SD (n=6). *P<0.05, **P<0.01 vs HFD.

References 38

[1]	Turner NA, Anderson DJ. Hospital infection control: Clostridioides difficile [J]. Clin Colon Rectal Surg, 2020, 33(2): 98-108. doi：10.1055/s-0040-1701234
[2]	Bishara J, Farah R, Mograbi J, et al. Obesity as a risk factor for Clostridium difficile infection[J]. Clin Infect Dis, 2013, 57(4): 489-93. doi：10.1093/cid/cit280
[3]	Mulki R, Baumann AJ, Alnabelsi T, et al. Body mass index greater than 35 is associated with severe Clostridium difficile infection[J]. Aliment Pharmacol Ther, 2017, 45(1): 75-81. doi：10.1111/apt.13832
[4]	Nathanson BH, Higgins TL, McGee WT. The dangers of extreme body mass index values in patients with Clostridium difficile [J]. Infection, 2017, 45(6): 787-93. doi：10.1007/s15010-017-1036-x
[5]	Le Chatelier E, Nielsen T, Qin JJ, et al. Richness of human gut microbiome correlates with metabolic markers[J]. Nature, 2013, 500(7464): 541-6.
[6]	Turnbaugh PJ, Hamady M, Yatsunenko T, et al. A core gut microbiome in obese and lean twins[J]. Nature, 2009, 457(7228): 480-4. doi：10.1038/nature07540
[7]	Cotillard A, Kennedy SP, Kong LC, et al. Dietary intervention impact on gut microbial gene richness[J]. Nature, 2013, 500(7464): 585-8. doi：10.1038/nature12738
[8]	Boulangé CL, Neves AL, Chilloux J, et al. Impact of the gut microbiota on inflammation, obesity, and metabolic disease[J]. Genome Med, 2016, 8(1): 42. doi：10.1186/s13073-016-0303-2
[9]	Kelly CR, Fischer M, Allegretti JR, et al. ACG clinical guidelines: prevention, diagnosis, and treatment of Clostridioides difficile infections[J]. Am J Gastroenterol, 2021, 116(6): 1124-47. doi：10.14309/ajg.0000000000001278
[10]	Chiu CW, Tsai PJ, Lee CC, et al. Application of microbiome management in therapy for Clostridioides difficile infections: from fecal microbiota transplantation to probiotics to microbiota-preserving antimicrobial agents[J]. Pathogens, 2021, 10(6): 649. doi：10.3390/pathogens10060649
[11]	de Vos WM, Tilg H, Van Hul M, et al. Gut microbiome and health: mechanistic insights[J]. Gut, 2022, 71(5): 1020-32. doi：10.1136/gutjnl-2021-326789
[12]	Qin JJ, Li YR, Cai ZM, et al. A metagenome-wide association study of gut microbiota in type 2 diabetes[J]. Nature, 2012, 490(7418): 55-60.
[13]	Fei N, Zhao LP. An opportunistic pathogen isolated from the gut of an obese human causes obesity in germfree mice[J]. ISME J, 2013, 7(4): 880-4. doi：10.1038/ismej.2012.153
[14]	Hazleton KZ, Martin CG, Orlicky DJ, et al. Dietary fat promotes antibiotic-induced Clostridioides difficile mortality in mice[J]. NPJ Biofilms Microbiomes, 2022, 8(1): 15. doi：10.1038/s41522-022-00276-1
[15]	Mefferd CC, Bhute SS, Phan JR, et al. A high-fat/high-protein, atkins-type diet exacerbates Clostridioides (Clostridium) difficile infection in mice, whereas a high-carbohydrate diet protects[J]. mSystems, 2020, 5(1): e00765-19. doi：10.1128/msystems.00765-19
[16]	Blaak EE, Canfora EE, Theis S, et al. Short chain fatty acids in human gut and metabolic health[J]. Benef Microbes, 2020, 11(5): 411-55. doi：10.3920/bm2020.0057
[17]	Litvak Y, Byndloss MX, Bäumler AJ. Colonocyte metabolism shapes the gut microbiota[J]. Science, 2018, 362(6418): eaat9076. doi：10.1126/science.aat9076
[18]	Tian HL, Cui JQ, Ye C, et al. Depletion of butyrate-producing microbes of the Firmicutes predicts nonresponse to FMT therapy in patients with recurrent Clostridium difficile infection[J]. Gut Microbes, 2023, 15(1): 2236362. doi：10.1080/19490976.2023.2236362
[19]	Stoeva MK, Garcia-So J, Justice N, et al. Butyrate-producing human gut symbiont, Clostridium butyricum, and its role in health and disease[J]. Gut Microbes, 2021, 13(1): 1907272. doi：10.1080/19490976.2021.1907272
[20]	Wang SQ, Xiang LY, Li F, et al. Butyrate protects against Clostridium difficile infection by regulating bile acid metabolism[J]. Microbiol Spectr, 2023, 11(4): e04479-22. doi：10.1128/spectrum.04479-22
[21]	Fachi JL, de Souza Felipe J, Pral LP, et al. Butyrate protects mice from Clostridium difficile-induced colitis through an HIF-1-dependent mechanism[J]. Cell Rep, 2019, 27(3): 750-61.e7. doi：10.1016/j.celrep.2019.03.054
[22]	Wang SQ, Lv D, Jiang SH, et al. Quantitative reduction in short-chain fatty acids, especially butyrate, contributes to the progression of chronic kidney disease[J]. Clin Sci, 2019, 133(17): 1857-70. doi：10.1042/cs20190171
[23]	Qiu JX, Ma YH, Qiu J. Regulation of intestinal immunity by dietary fatty acids[J]. Mucosal Immunol, 2022, 15(5): 846-56. doi：10.1038/s41385-022-00547-2
[24]	Sun PH, Wang ML, Liu YX, et al. High-fat diet-disturbed gut microbiota-colonocyte interactions contribute to dysregulating peripheral tryptophan-kynurenine metabolism[J]. Microbiome, 2023, 11(1): 154. doi：10.1186/s40168-023-01606-x
[25]	Schaeffler A, Gross P, Buettner R, et al. Fatty acid-induced induction of Toll-like receptor-4/nuclear factor-kappaB pathway in adipocytes links nutritional signalling with innate immunity[J]. Immunology, 2009, 126(2): 233-45. doi：10.1111/j.1365-2567.2008.02892.x
[26]	Hryckowian AJ, Van Treuren W, Smits SA, et al. Microbiota-accessible carbohydrates suppress Clostridium difficile infection in a murine model[J]. Nat Microbiol, 2018, 3(6): 662-9. doi：10.1038/s41564-018-0150-6
[27]	Pensinger DA, Fisher AT, Dobrila HA, et al. Butyrate differentiates permissiveness to Clostridioides difficile infection and influences growth of diverse C. difficile isolates[J]. Infect Immun, 2023, 91(2): e00570-22. doi：10.1128/iai.00570-22
[28]	Pensinger DA, Dobrila HA, Stevenson DM, et al. Exogenous butyrate inhibits butyrogenic metabolism and alters virulence phenotypes in Clostridioides difficile [J]. mBio, 2024, 15(3): e02535-23. doi：10.1128/mbio.02535-23
[29]	Karlsson S, Lindberg A, Norin E, et al. Toxins, butyric acid, and other short-chain fatty acids are coordinately expressed and down-regulated by cysteine in Clostridium difficile [J]. Infect Immun, 2000, 68(10): 5881-8. doi：10.1128/iai.68.10.5881-5888.2000
[30]	Baldassare MA, Bhattacharjee D, Coles JD, et al. Butyrate enhances Clostridioides difficile sporulation in vitro [J]. J Bacteriol, 2023, 205(9): e00138-23. doi：10.1128/jb.00138-23
[31]	Li GF, Lin J, Zhang C, et al. Microbiota metabolite butyrate constrains neutrophil functions and ameliorates mucosal inflammation in inflammatory bowel disease[J]. Gut Microbes, 2021, 13(1): 1968257. doi：10.1080/19490976.2021.1968257
[32]	Salvi PS, Cowles RA. Butyrate and the intestinal epithelium: modulation of proliferation and inflammation in homeostasis and disease[J]. Cells, 2021, 10(7): 1775. doi：10.3390/cells10071775
[33]	Zhou D, Pan Q, Xin FZ, et al. Sodium butyrate attenuates high-fat diet-induced steatohepatitis in mice by improving gut microbiota and gastrointestinal barrier[J]. World J Gastroenterol, 2017, 23(1): 60-75. doi：10.3748/wjg.v23.i1.60
[34]	Coppola S, Avagliano C, Calignano A, et al. The protective role of butyrate against obesity and obesity-related diseases[J]. Molecules, 2021, 26(3): 682. doi：10.3390/molecules26030682
[35]	Luceri C, Femia AP, Fazi M, et al. Effect of butyrate enemas on gene expression profiles and endoscopic/histopathological scores of diverted colorectal mucosa: a randomized trial[J]. Dig Liver Dis, 2016, 48(1): 27-33. doi：10.1016/j.dld.2015.09.005
[36]	Barnes D, Ng K, Smits S, et al. Competitively selected donor fecal microbiota transplantation: butyrate concentration and diversity as measures of donor quality[J]. J Pediatr Gastroenterol Nutr, 2018, 67(2): 185-7. doi：10.1097/mpg.0000000000001940
[37]	Facchin S, Vitulo N, Calgaro M, et al. Microbiota changes induced by microencapsulated sodium butyrate in patients with inflammatory bowel disease[J]. Neurogastroenterol Motil, 2020, 32(10): e13914. doi：10.1111/nmo.13914
[38]	Cao SJ, Budina E, Raczy MM, et al. A serine-conjugated butyrate prodrug with high oral bioavailability suppresses autoimmune arthritis and neuroinflammation in mice[J]. Nat Biomed Eng, 2024, 8(5): 611-27. doi：10.1038/s41551-024-01190-x