Eurycomanone inhibits renal ischemia/reperfusion-induced mitochondrial dysfunction and inflammation in mice by binding to STAT3 to inhibit its phosphorylation

doi:10.12122/j.issn.1673-4254.2026.03.11

Abstract

Abstract:

Objective To investigate the mechanism of eurycomanone (EN) for ameliorating ischemia/reperfusion (IR)-induced acute kidney injury (AKI) in mice. Methods Twenty-four male C57BL/6J mice were randomly divided into 4 groups (n=6) for sham operation, IR modeling by bilateral renal pedicle clamping, or intraperitoneal injections of EN at 0.25 or 1.0 mg/kg for two days prior to surgery. Network pharmacology and molecular docking were used to identify the potential molecular targets and signaling pathways and evaluate the binding affinities. Renal function, histopathological changes, expression of tubular injury markers (KIM-1 and NGAL), phosphorylation levels of STAT3, PI3K, and JAK2, renal inflammation, mitochondrial biogenesis, and mitochondrial function of the mice were assessed. The interaction between EN and STAT3 was examined using surface plasmon resonance (SPR). Another 24 male C57BL/6J mice receiving sham operation, IR modeling, or EN or EN+ML115 (a STAT3 agonist) treatment prior to modeling (n=6) were used to validate the role of STAT3 in EN-mediated renal protection. Results Both low- and high-dose EN significantly alleviated renal injury and improved renal function in mice with IR-induced AKI. The core targets of EN were associated with inflammation-related signaling pathways. EN treatment markedly reduced renal levels of IL-6, MCP-1, and TNF-αand decreased macrophage infiltration (F4/80-positive cells) in renal interstitial tissue of the mice. EN also significantly increased renal ATP content and mitochondrial DNA copy number (P<0.05), and upregulated the expressions of PGC-1α, TFAM, and Nrf2 mRNAs and protein levels of PGC-1α and TOM20. Molecular docking identified STAT3 and PI3K as key molecular targets of EN. In mice with IR-induced AKI, EN significantly suppressed phosphorylation of STAT3 and PI3K in the renal tissues without affecting p-JAK2 levels. SPR analysis confirmed a direct and specific interaction between EN and STAT3. Notably, activation of STAT3 by ML115 significantly reversed the renoprotective effects of EN. Conclusion EN mitigates IR-induced AKI in mice by directly binding to STAT3 to inhibit its phosphorylation, suppressing inflammation, and enhancing mitochondrial biogenesis and function, suggesting the potential of EN as a promising therapeutic candidate for IR-induced AKI.

Key words: eurycomanone, acute kidney injury, ischemia-reperfusion, STAT3, mitochondrial biogenesis, inflammation

Ze LIU, Zhangkun MAO, Da YOU, Junjie WANG, Yongmei HE, Yiwen YU, Zhiqiang WEN, Huilong FANG, Wenxia HE. Eurycomanone inhibits renal ischemia/reperfusion-induced mitochondrial dysfunction and inflammation in mice by binding to STAT3 to inhibit its phosphorylation[J]. Journal of Southern Medical University, 2026, 46(3): 570-581.

Figures/Tables 10

Tab.1 Primer sequence for qRT-PCR

Gene name	Forward (5′-3′)	Reverse (5′-3′)
NGAL	ATGTCACCTCCATCCTGGTCAG	GCCACTTGCACATTGTAGCTCTG
KIM-1	ACATATCGTGGAATCACAACGAC	ACTGCTCTTCTGATAGGTGACA
TNF-α	CAGGCGGTGCCTATGTCTC	CGATCACCCCGAAGTTCAGTAG
MCP-1	TAAAAACCTGGATCGGAACCAAA	GCATTAGCTTCAGATTTACGGGT
IL-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
PGC-1α	TGAACGCACCTTAAGTGTGGAA	GGGTTATCTTGGTTGGCTTTATGA
TFAM	CACCCAGATGCAAAACTTTCAG	CTGCTCTTTATACTTGCTCACAG
Nrf2	AAAGCACAGCCAGCACATTC	GGGATTCACGCATAGGAGCA
GAPDH	GGTGAAGGTCGGTGTGAACG	CTCGCTCCTGGAAGATGGTG
ND1	GGATCCGAGCATCTTATCCA	GGTGGTACTCCCGCTGTAAA
S18	TTCCAGCACATTTTGCGAGTA	CACGCCCTTAATGGCAGTGAT

Fig.1 EN pretreatment alleviates ischemia/reperfusion (IR)-induced acute kidney injury (AKI) in mice. A: Schematic diagram of the animal study protocol. B, C: SCr and BUN levels in each group. D: HE staining showing the renal injury in the mice. The lower panels (Scale bar=50 μm) are magnified images of the boxed areas in the upper panels (Scale bar=100 μm). Asterisks indicate damaged tubules. E: Quantitative assessment of renal injury. F, G: qRT-PCR for detecting mRNA levels of KIM-1 and NGAL in the renal tissues. H-J: Western blotting for KIM-1 and NGAL expressions. #P<0.05 vs sham group, *P<0.05 vs IR group, ※P<0.05 vs IR+EN-L group (n=6).

Fig.2 GO and KEGG enrichment analysis of the intersection targets. A: Molecular structure of EN. B: Venn diagram of the EN targets, IR targets and AKI targets. C-E: Top 10 items for the biological process (BP), molecular functional (MF) and cellular component (CC) enrichment analysis in GO enrichment analysis. F: The top 8 inflammatory enrichment signaling pathways from KEGG pathway enrichment analysis.

Fig.3 EN suppresses renal inflammation in mice with IR-induced AKI in mice. A-C: qRT-PCR for detecting mRNA levels of MCP-1, TNF‑α and IL-6. D, E: Immunofluorescence staining showed infiltration of F4/80-positvie cells (arrows) in mouse renal tissues (Scale bar=50 μm). #P<0.05 vs sham group, *P<0.05 vs IR group, ※P<0.05 vs IR+EN-L group (n=6).

Fig.4 EN rescues renal mitochondrial function by promoting mitochondrial biogenesis in mice with IR-induced AKI. A: Quantification of ATP content. B: Quantification of mtDNA copy number. C-E: qRT-PCR for detecting mRNA level of PGC-1α, TFAM and Nrf2. F-H: Western blotting for PGC-1α and TOM 20 expressions. #P<0.05 vs sham group, *P<0.05 vs IR group, ※P<0.05 vs IR+EN-L group (n=6).

Fig.5 Construction of the protein-protein interaction (PPI) network and compound-target (C-T) network. A: The PPI network among the potential targets of EN against IR-induced AKI. B: The C-T network between EN and the potential targets. Square: EN compound; Circle: Predicted targets.

Tab.2 Molecular docking of EN with the core targets

Target	Score	Degree	RCSB ID
STAT3	-7.7	24	6QHD
PIK3CA	-9.1	15	8BFU
TLR4	-6.7	15	2Z62
PIK3R1	-6.8	14	1PHT
PIK3CB	-9.0	13	2Y2A
PIK3CD	-8.2	13	5IS5
HSP90AB1	-7.4	12	2NMQ
PTPN11	-8.7	11	3O5X
HIF1A	-7.9	10	1H2K
HDAC2	-9.2	10	4LXZ
PDGFRB	-6.7	10	1H9O
ITGB1	-8.1	9	4DX9
NR3C1	-7.4	9	3BQD
PIK3CG	-8.6	9	2CHW
PDGFRA	-7.5	8	5GRN
RXRA	-7.3	8	4N5G
PRKCD	-7.0	8	1YRK
NFKB1	-7.2	8	7LEQ
AR	-6.6	8	1E3G

Fig.6 Visualization of molecular docking between the core targets and EN. A: Schematic diagram of molecular docking between EN and STAT3. B-F: Schematic diagram of molecular docking between EN with different subunits of PI3K, including PIK3CA, PIK3CB, PIK3CD, PIK3CG and PIK3R1.

Fig.7 EN suppresses phosphorylation of STAT3 by binding to STAT3. A-C: Western blotting for p-STAT3, STAT3, p-PI3K and PI3K expressions in the renal tissues. D-E: Western blotting for p-JAK2 and JAK2 expressions in the renal tissues. #P<0.05 vs sham group, *P<0.05 vs IR group, ※P<0.05 vs IR+EN-L group (n=6). F: SPR test using Biacore demonstrating the stable fit of the interaction between EN and STAT3.

Fig.8 STAT3 agonist ML115 reduces EN-mediated renal and anti-inflammatory protection in IR-AKI mice. A, B: SCr and BUN levels in each group. C: Quantitative assessment of renal injury. D: HE staining show the morphological injury. The lower panels (Scale bar=50 μm) are magnified images of the boxed areas in the upper panels (Scale bar=100 μm). Asterisks indicate damaged tubules. E, F: qRT-PCR for detecting mRNA levels of KIM-1 and NGAL in the renal tissues. G-I: Western blotting for KIM-1 and NGAL expressions. J-L: qRT-PCR for detecting mRNA levels of MCP-1, TNF-α and IL-6. #P<0.05 vs sham group, *P<0.05 vs IR group, ※P<0.05 vs IR+EN group (n=6).

References 33

[1]	Kellum JA, Romagnani P, Ashuntantang G, et al. Acute kidney injury[J]. Nat Rev Dis Primers, 2021, 7(1): 52. doi：10.1038/s41572-021-00284-z
[2]	Niculae A, Gherghina ME, Peride I, et al. Pathway from acute kidney injury to chronic kidney disease: molecules involved in renal fibrosis[J]. Int J Mol Sci, 2023, 24(18): 14019. doi：10.3390/ijms241814019
[3]	Chen LC, Yuan JX, Li H, et al. Trans-cinnamaldehyde attenuates renal ischemia/reperfusion injury through suppressing inflammation via JNK/p38 MAPK signaling pathway[J]. Int Immunopharmacol, 2023, 118: 110088. doi：10.1016/j.intimp.2023.110088
[4]	Chen YM, Li ZX, Zhang HY, et al. Mitochondrial metabolism and targeted treatment strategies in ischemic-induced acute kidney injury[J]. Cell Death Discov, 2024, 10(1): 69. doi：10.1038/s41420-024-01843-5
[5]	Ma HJ, Guo XZ, Cui SC, et al. Dephosphorylation of AMP-activated protein kinase exacerbates ischemia/reperfusion-induced acute kidney injury via mitochondrial dysfunction[J]. Kidney Int, 2022, 101(2): 315-30. doi：10.1016/j.kint.2021.10.028
[6]	Vijayan A. Tackling AKI: prevention, timing of dialysis and follow-up[J]. Nat Rev Nephrol, 2021, 17(2): 87-8. doi：10.1038/s41581-020-00390-3
[7]	Huang JW, Liang Y, Zhou LL. Natural products for kidney disease treatment: Focus on targeting mitochondrial dysfunction[J]. Front Pharmacol, 2023, 14: 1142001. doi：10.3389/fphar.2023.1142001
[8]	Ahmad N, Samiulla DS, Teh BP, et al. Bioavailability of eurycomanone in its pure form and in a standardised Eurycoma longifolia water extract[J]. Pharmaceutics, 2018, 10(3): 90. doi：10.3390/pharmaceutics10030090
[9]	Yunos NM, Wahab HA, Al-Thiabat MG, et al. In vitro and in silico analysis of the anticancer effects of eurycomanone and euryco-malactone from Eurycoma longifolia [J]. Plants, 2023, 12(15): 2827. doi：10.3390/plants12152827
[10]	Ye GQ, Xu MT, Shu YH, et al. A quassinoid diterpenoid euryco-manone from Eurycoma longifolia jack exerts anti-cancer effect through autophagy inhibition[J]. Molecules, 2022, 27(14): 4398. doi：10.3390/molecules27144398
[11]	Balan D, Chan KL, Murugan D, et al. Antiadipogenic effects of a standardized quassinoids-enriched fraction and eurycomanone from Eurycoma longifolia [J]. Phytother Res, 2018, 32(7): 1332-45. doi：10.1002/ptr.6065
[12]	Zhong YT, Liao HB, Ye ZQ, et al. Eurycomanone stimulates bone mineralization in zebrafish larvae and promotes osteogenic differentiation of mesenchymal stem cells by upregulating AKT/GSK-3β/β-catenin signaling[J]. J Orthop Translat, 2023, 40: 132-46. doi：10.1016/j.jot.2023.05.006
[13]	Liu Z, Li H, Su JQ, et al. Numb depletion promotes Drp1-mediated mitochondrial fission and exacerbates mitochondrial fragmentation and dysfunction in acute kidney injury[J]. Antioxid Redox Signal, 2019, 30(15): 1797-816. doi：10.1089/ars.2017.7432
[14]	Zhao M, Wang YZ, Li L, et al. Mitochondrial ROS promote mitochondrial dysfunction and inflammation in ischemic acute kidney injury by disrupting TFAM-mediated mtDNA maintenance[J]. Theranostics, 2021, 11(4): 1845-63. doi：10.7150/thno.50905
[15]	Chaudhary S, Kashani KB. Acute kidney injury management strategies peri-cardiovascular interventions[J]. Interv Cardiol Clin, 2023, 12(4): 555-72. doi：10.1016/j.iccl.2023.06.008
[16]	McWilliam SJ, Wright RD, Welsh GI, et al. The complex interplay between kidney injury and inflammation[J]. Clin Kidney J, 2020, 14(3): 780-8. doi：10.1093/ckj/sfaa164
[17]	Trang NTH, Trang TT, Nam NT. Cytokine inhibitory activity of eurycomanone in RAW 264.7 cells stimulated with viral-mimicking poly (I: C)[J]. Vietnam J Biotechnol, 2023, 21(3): 435-41. doi：10.15625/1811-4989/20291
[18]	Hajjouli S, Chateauvieux S, Teiten MH, et al. Eurycomanone and eurycomanol from Eurycoma longifolia jack as regulators of signaling pathways involved in proliferation, cell death and inflammation[J]. Molecules, 2014, 19(9): 14649-66. doi：10.3390/molecules190914649
[19]	Feng YS, Imam Aliagan A, Tombo N, et al. RIP3 translocation into mitochondria promotes mitofilin degradation to increase inflammation and kidney injury after renal ischemia-reperfusion[J]. Cells, 2022, 11(12): 1894. doi：10.3390/cells11121894
[20]	Abu Shelbayeh O, Arroum T, Morris S, et al. PGC-1α is a master regulator of mitochondrial lifecycle and ROS stress response[J]. Antioxidants, 2023, 12(5): 1075. doi：10.3390/antiox12051075
[21]	Ma LY, Hui JL, He GT, et al. DNAJC6 in acute kidney injury: a novel target for protecting renal tubular epithelial cells through PGC-1α-mediated mitochondrial homeostasis[J]. Exp Cell Res, 2025, 450(2): 114682. doi：10.1016/j.yexcr.2025.114682
[22]	Yu JT, Fan S, Li XY, et al. Novel insights into STAT3 in renal diseases[J]. Biomed Pharmacother, 2023, 165: 115166. doi：10.1016/j.biopha.2023.115166
[23]	Zhao XY, Zhang EF, Ren XF, et al. Edaravone alleviates cell apoptosis and mitochondrial injury in ischemia-reperfusion-induced kidney injury via the JAK/STAT pathway[J]. Biol Res, 2020, 53(1): 28. doi：10.1186/s40659-020-00297-0
[24]	Liu Y, Wang L, Du Y, et al. Effects of apigenin pretreatment against renal ischemia/reperfusion injury via activation of the JAK2/STAT3 pathway[J]. Biomed Pharmacother, 2017, 95: 1799-808. doi：10.1016/j.biopha.2017.09.091
[25]	Xu MJ, Feng DC, Wang H, et al. IL-22 ameliorates renal ischemia-reperfusion injury by targeting proximal tubule epithelium[J]. J Am Soc Nephrol, 2014, 25(5): 967-77. doi：10.1681/asn.2013060611
[26]	Bilanges B, Posor Y, Vanhaesebroeck B. PI3K isoforms in cell signalling and vesicle trafficking[J]. Nat Rev Mol Cell Biol, 2019, 20(9): 515-34. doi：10.1038/s41580-019-0129-z
[27]	Liu C, Chen K, Wang HX, et al. Gastrin attenuates renal ischemia/reperfusion injury by a PI3K/Akt/bad-mediated anti-apoptosis signaling[J]. Front Pharmacol, 2020, 11: 540479. doi：10.3389/fphar.2020.540479
[28]	Tang Z, Wang Y, Liu Y, et al. Salidroside inhibits renal ischemia/reperfusion injury-induced ferroptosis by the PI3K/AKT signaling pathway[J]. Exp Ther Med, 2023, 26(5): 507. doi：10.3892/etm.2023.12206
[29]	Pace J, Paladugu P, Das B, et al. Targeting STAT3 signaling in kidney disease[J]. Am J Physiol Renal Physiol, 2019, 316(6): F1151-61. doi：10.1152/ajprenal.00034.2019
[30]	Huang F, Wang X, Xiao GF, et al. Loganin exerts a protective effect on ischemia-reperfusion-induced acute kidney injury by regulating JAK2/STAT3 and Nrf2/HO-1 signaling pathways[J]. Drug Dev Res, 2022, 83(1): 150-7. doi：10.1002/ddr.21853
[31]	Park JY, Yoo KD, Bae E, et al. Blockade of STAT3 signaling alleviates the progression of acute kidney injury to chronic kidney disease through antiapoptosis[J]. Am J Physiol Renal Physiol, 2022, 322(5): F553-72. doi：10.1152/ajprenal.00595.2020
[32]	Ogura M, Uchida T, Terui Y, et al. Phase I study of OPB-51602, an oral inhibitor of signal transducer and activator of transcription 3, in patients with relapsed/refractory hematological malignancies[J]. Cancer Sci, 2015, 106(7): 896-901. doi：10.1111/cas.12683
[33]	Okusaka T, Ueno H, Ikeda M, et al. Phase 1 and pharmacological trial of OPB-31121, a signal transducer and activator of transcription-3 inhibitor, in patients with advanced hepatocellular carcinoma[J]. Hepatol Res, 2015, 45(13): 1283-91. doi：10.1111/hepr.12504