EVA1A overexpression improves non-alcoholic fatty liver disease in mice by regulating lipid metabolism and promoting lipophagy

doi:10.12122/j.issn.1673-4254.2026.01.16

Abstract

Abstract:

Objective To investigate the role of transmembrane protein EVA1A in liver lipid metabolism and development of non-alcoholic fatty liver disease (NAFLD). Methods Eight-week-old male ob/ob mice were randomized into control group injected with AAV null vector via the tail vein (AAV-null group) and AAV-Eva1a group injected with recombinant vector AAV-Eva1a (n=8). HepG2 cells transfected with the lentiviral vector LV-EVA1A or the null vector were induced with oleic acid to construct a cell model of NAFLD. The expression levels of EVA1A, lipid metabolism-related and autophagy-related genes in mouse livers were detected with RT-qPCR, Western blotting, and immunofluorescence staining, and lipid accumulation in mouse livers and blood and in the treated cells was examined with HE and Oil Red O staining and lipid detection kits. Serum levels of ALT, AST, IL-6, IL-1β, and TNF-α of the mice were detected, and hepatic lipophagy was observed with transmission electron microscopy. Results The mouse livers in AAV-Eva1a group and LV-EVA1A-transfected cells showed significantly increased expression levels of EVA1A mRNA and protein. The liver weight and coefficient and lipid deposition of the mice with AAV-Eva1a injection and triglyceride (TG) content in LV-EVA1A-transfected cells were significantly decreased. The mice in AAV-Eva1a group showed significantly reduced serum total cholesterol, LDL-C, and HDL-C levels and hepatic TG levels with lowered serum levels of ALT, AST, IL-6 and TNF‑α. In both mouse livers in AAV-Eva1a group and LV-EVA1A-transfected HepG2 cells, acetyl-CoA carboxylase, fatty acid transport protein, and diacylglycerol acyltransferase expressions were all significantly decreased and adipose triglyceride lipase increased. Hepatic lipophagy, autophagosome numbers and LC3-II and ATG5 expressions were enhanced and p62 expression was lowered in the mice in AAV-Eva1a group and LV-EVA1A-transfected cells. Conclusion EVA1A overexpression alleviates fatty liver and inflammation in ob/ob mice by regulating lipid metabolism-related genes and enhancing lipophagy to promote clearance of accumulated hepatic lipids.

Key words: fatty liver, EVA1A, inflammation, lipid metabolism, lipophagy

Jiayi XU, Di YANG, Kailai ZANG, Mengen CHU, Qingyao ZHAO, Qing LI, Sen LU, Xiuli CHEN, Ning LI. EVA1A overexpression improves non-alcoholic fatty liver disease in mice by regulating lipid metabolism and promoting lipophagy[J]. Journal of Southern Medical University, 2026, 46(1): 150-158.

Figures/Tables 5

Tab.1 Primers sequences for RT-qPCR

Gene	Forward primer (5'-3') Reverse primer (5'-3')
Mus Eva1a Homo EVA1A	CCTTGGCCGCCTTGGTGATGAG TACCATCCTCGCTGTCGCTGCT AGATGGCTTTGCTCAGCAACA GATGCACACGCCAGAAACAA
Mus ACC1	TCGGATCGGTTCCTTTGGGCCT TGTTCGCTGCCACGTAGATGCG
Mus CD36	TGACGTGGCAAAGAACAGCAGCA AGACACAGTGTGGTCCTCGGGG
Mus DGAT2	TCCCAGCAGCTGTGGCCTTACT GCACCACAGGTTGACATCCCGG
Mus ATGL Mus β-actin Homo β-actin	TCCAAGGGGTGCGCTATGTGGA GTGGAGCTGTCCTGAGGGCAGA CCCGGGCTGTATTCCCCTCCAT CCTCTCTTGCTCTGGGCCTCGT AGGATTCCTATGTGGGCGAC ATAGCACAGCCTGGATAGCAA

Fig.1 Overexpression of Eva1a in ob/ob mouse liver. A: Relative hepatic Eva1a mRNA levels. B: Immunofluorescence staining for detecting Eva1a expression in mouse liver tissues (Original magnification: ×200). C: Hepatic Eva1a protein expression levels detected with Western blotting. AAV-Eva1a: Mice overexpressing Eva1a; AAV-null: Control mice. *P<0.05, **P<0.01, ***P<0.001 vs AAV-null group.

Fig.2 Effect of EVA1A overexpression on steatosis and inflammation in ob/ob mice and on lipid deposition in OA-induced HepG2 cells. A: Observation of mouse livers. B: Liver tissue HE staining and Oil Red O (ORO) staining (×200). C: Liver weight and liver coefficients of the mice. D: Triglyceride (TG) and total cholesterol (TC) levels in mouse livers, and TG, TC, low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) levels in mouse serum. E: Serum levels of AST, ALT, IL-6, IL-1β, and TNF‑α of the mice. F: Infection efficiency of LV-EVA1A or LV-Vector in HepG2 cells determined by fluorescence microscopy (×200). G: RT-qPCR analysis of Eva1a mRNA levels in HepG2 cells infected with LV-EVA1A or LV-Vector. H: Western blotting of EVA1A protein levels in HepG2 cells infected with LV-EVA1A or LV-Vector. I: ORO staining for lipid droplets in the cells in LV-Vector and LV-EVA1A groups treated with 400 μmol/L OA for 12 h (×400). J: Quantitative analysis of cellular TG contents. AAV-Eva1a: Mice overexpressing Eva1a; AAV-null: Control mice. LV-EVA1A: HepG2 cells overexpressing EVA1A; LV-Vector: Control cells. *P<0.05, **P<0.01, ***P<0.001 vs AAV-null group or LV-Vector group.

Fig.3 Effect of EVA1A overexpression on expression of lipid metabolism-related genes in the liver of ob/ob mice and in HepG2 cells induced by OA. A: Relative hepatic mRNA levels of CD36, ACC1, DGAT2 and ATGL. B: Protein expression levels of ACC1, CD36, and ATGL in the liver of ob/ob mice. C: Protein expression levels of ACC1, CD36, and ATGL in HepG2 cells treated with OA. *P<0.05, **P<0.01, ***P<0.001 vs AAV-null group or LV-Vector group.

Fig.4 Effect of Eva1a overexpression on lipophagy in the liver of ob/ob mice and in OA-induced HepG2 cells. A: Lipophagy in mouse liver observed with transmission electron microscopy (×30 000). B: Immunofluorescence staining of LC3-labeled autophagosomes in HepG2 cells treated with OA (×1260). C: Protein expression levels of autophagy-related genes p62, LC3, and ATG5 in ob/ob mouse liver. D: Protein expression levels of autophagy-related genes p62, LC3, and ATG5 in HepG2 cells treated with OA. The red arrows indicate lipid droplets. *P<0.05, **P<0.01, ***P<0.001 vs AAV-null group or LV-Vector group.

References 38

[1]	Pouwels S, Sakran N, Graham Y, et al. Non-alcoholic fatty liver disease (NAFLD): a review of pathophysiology, clinical management and effects of weight loss[J]. BMC Endocr Disord, 2022, 22(1): 63. doi：10.1186/s12902-022-00980-1
[2]	Shi MR, Zhang H, Wang W, et al. Effect of dapagliflozin on liver and pancreatic fat in patients with type 2 diabetes and non-alcoholic fatty liver disease[J]. J Diabetes Complicat, 2023, 37(10): 108610. doi：10.1016/j.jdiacomp.2023.108610
[3]	Xu S, Wu X, Wang S, et al. TRIM56 protects against nonalcoholic fatty liver disease by promoting the degradation of fatty acid synthase[J]. J Clin Invest, 2024, 134(5): e166149. doi：10.1172/jci166149
[4]	Wang L, Yu CF, Lu Y, et al. TMEM166, a novel transmembrane protein, regulates cell autophagy and apoptosis[J]. Apoptosis, 2007, 12(8): 1489-502. doi：10.1007/s10495-007-0073-9
[5]	Hu J, Li G, Qu L, et al. TMEM166/EVA1A interacts with ATG16L1 and induces autophagosome formation and cell death[J]. Cell Death Dis, 2016, 7(8): e2323. doi：10.1038/cddis.2016.230
[6]	De Minicis S, Day C, Svegliati-Baroni G. From NAFLD to NASH and HCC: pathogenetic mechanisms and therapeutic insights[J]. Curr Pharm Des, 2013, 19(29): 5239-49. doi：10.2174/13816128130303
[7]	Lu GD, Ang YH, Zhou J, et al. CCAAT/enhancer binding protein α predicts poorer prognosis and prevents energy starvation-induced cell death in hepatocellular carcinoma[J]. Hepatology, 2015, 61(3): 965-78. doi：10.1002/hep.27593
[8]	Xu Q, Liao Z, Gong Z, et al. Down-regulation of EVA1A by miR-103a-3p promotes hepatocellular carcinoma cells proliferation and migration[J]. Cell Mol Biol Lett, 2022, 27(1): 93. doi：10.1186/s11658-022-00388-8
[9]	Yang JJ, Wang B, Xu Q, et al. TMEM166 inhibits cell proliferation, migration and invasion in hepatocellular carcinoma via upregulating TP53[J]. Mol Cell Biochem, 2021, 476(2): 1151-63. doi：10.1007/s11010-020-03979-1
[10]	Zhen Y, Yuan Z, Zhang J, et al. Flubendazole induces mitochondrial dysfunction and DRP1-mediated mitophagy by targeting EVA1A in breast cancer[J]. Cell Death Dis, 2022, 13(4): 375. doi：10.1038/s41419-022-04823-8
[11]	Lin X, Cui M, Xu D, et al. Liver-specific deletion of Eva1a/Tmem166 aggravates acute liver injury by impairing autophagy[J]. Cell Death Dis, 2018, 9(7): 768. doi：10.1038/s41419-018-0800-x
[12]	Li MT, Lu G, Hu J, et al. EVA1A/TMEM166 regulates embryonic neurogenesis by autophagy[J]. Stem Cell Rep, 2016, 6(3): 396-410. doi：10.1016/j.stemcr.2016.01.011
[13]	Liu B, Liu B, Zhou Y, et al. EVA1A regulates hematopoietic stem cell regeneration via ER-mitochondria mediated apoptosis[J]. Cell Death Dis, 2023, 14(1): 71. doi：10.1038/s41419-023-05559-9
[14]	Canham L, Sendac S, Diagbouga MR, et al. EVA1A (Eva-1 homolog A) promotes endothelial apoptosis and inflammatory activation under disturbed flow via regulation of autophagy[J]. Arterioscler Thromb Vasc Biol, 2023, 43(4): 547-61. doi：10.1161/atvbaha.122.318110
[15]	Li J, Chen Y, Gao J, et al. Eva1a ameliorates atherosclerosis by promoting re-endothelialization of injured arteries via Rac1/Cdc42/Arpc1b[J]. Cardiovasc Res, 2021, 117(2): 450-61. doi：10.1093/cvr/cvaa011
[16]	Liu XK, Gao X, Yang YL, et al. EVA1A reverses lenvatinib resistance in hepatocellular carcinoma through regulating PI3K/AKT/p53 signaling axis[J]. Apoptosis, 2024, 29(7): 1161-84. doi：10.1007/s10495-024-01967-0
[17]	Li YX, Huang XG, Yang G, et al. CD36 favours fat sensing and transport to govern lipid metabolism[J]. Prog Lipid Res, 2022, 88: 101193. doi：10.1016/j.plipres.2022.101193
[18]	Yang YX, Liu XK, Yang D, et al. Interplay of CD36, autophagy, and lipid metabolism: insights into cancer progression[J]. Metabolism, 2024, 155: 155905. doi：10.1016/j.metabol.2024.155905
[19]	Zeng H, Qin H, Liao M, et al. CD36 promotes de novo lipogenesis in hepatocytes through INSIG2-dependent SREBP1 processing[J]. Mol Metab, 2022, 57: 101428. doi：10.1016/j.molmet.2021.101428
[20]	Zeng S, Wu F, Chen M, et al. Inhibition of fatty acid translocase (FAT/CD36) palmitoylation enhances hepatic fatty acid β-oxidation by increasing its localization to mitochondria and interaction with long-chain acyl-CoA synthetase 1[J]. Antioxid Redox Signal, 2022, 36(16/17/18): 1081-100. doi：10.1089/ars.2021.0157
[21]	Zhu HL, Zhao TM, Zhao S, et al. O-GlcNAcylation promotes the progression of nonalcoholic fatty liver disease by upregulating the expression and function of CD36[J]. Metabolism, 2024, 156: 155914. doi：10.1016/j.metabol.2024.155914
[22]	Wilson CG, Tran JL, Erion DM, et al. Hepatocyte-specific disruption of CD36 attenuates fatty liver and improves insulin sensitivity in HFD-fed mice[J]. Endocrinology, 2016, 157(2): 570-85. doi：10.1210/en.2015-1866
[23]	Brownsey RW, Zhande R, Boone AN. Isoforms of acetyl-CoA carboxylase: structures, regulatory properties and metabolic functions[J]. Biochem Soc Trans, 1997, 25(4): 1232-8. doi：10.1042/bst0251232
[24]	Abu-Elheiga L, Matzuk MM, Abo-Hashema KA, et al. Continuous fatty acid oxidation and reduced fat storage in mice lacking acetyl-CoA carboxylase 2[J]. Science, 2001, 291(5513): 2613-6. doi：10.1126/science.1056843
[25]	Akheruzzaman M, Hegde V, Shin AC, et al. Reducing endogenous insulin is linked with protection against hepatic steatosis in mice[J]. Nutr Diabetes, 2020, 10(1): 11. doi：10.1038/s41387-020-0114-9
[26]	Gluchowski NL, Gabriel KR, Chitraju C, et al. Hepatocyte deletion of triglyceride-synthesis enzyme acyl CoA: diacylglycerol acyltransferase 2 reduces steatosis without increasing inflammation or fibrosis in mice[J]. Hepatology, 2019, 70(6): 1972-85. doi：10.1002/hep.30765
[27]	Bai R, Rebelo A, Kleeff J, et al. Identification of prognostic lipid droplet-associated genes in pancreatic cancer patients via bioinformatics analysis[J]. Lipids Health Dis, 2021, 20(1): 58. doi：10.1186/s12944-021-01476-y
[28]	Fang QH, Shen QL, Li JJ, et al. Inhibition of microRNA-124a attenuates non-alcoholic fatty liver disease through upregulation of adipose triglyceride lipase and the effect of liraglutide intervention[J]. Hepatol Res, 2019, 49(7): 743-57. doi：10.1111/hepr.13330
[29]	Reid BN, Ables GP, Otlivanchik OA, et al. Hepatic overexpression of hormone-sensitive lipase and adipose triglyceride lipase promotes fatty acid oxidation, stimulates direct release of free fatty acids, and ameliorates steatosis[J]. J Biol Chem, 2008, 283(19): 13087-99. doi：10.1074/jbc.m800533200
[30]	Saadati S, Sadeghi A, Mansour A, et al. Curcumin and inflammation in non-alcoholic fatty liver disease: a randomized, placebo controlled clinical trial[J]. BMC Gastroenterol, 2019, 19(1): 133. doi：10.1186/s12876-019-1055-4
[31]	Yu HY, Yang F, Zhong WT, et al. Secretory Galectin-3 promotes hepatic steatosis via regulation of the PPARγ/CD36 signaling pathway[J]. Cell Signal, 2021, 84: 110043. doi：10.1016/j.cellsig.2021.110043
[32]	Lin CW, Zhang H, Li M, et al. Pharmacological promotion of autophagy alleviates steatosis and injury in alcoholic and non-alcoholic fatty liver conditions in mice[J]. J Hepatol, 2013, 58(5): 993-9. doi：10.1016/j.jhep.2013.01.011
[33]	Blanchard PG, Festuccia WT, Houde VP, et al. Major involvement of mTOR in the PPARγ-induced stimulation of adipose tissue lipid uptake and fat accretion [S[J]. J Lipid Res, 2012, 53(6): 1117-25. doi：10.1194/jlr.m021485
[34]	Owen JL, Zhang Y, Bae SH, et al. Insulin stimulation of SREBP-1c processing in transgenic rat hepatocytes requires p70 S6-kinase[J]. Proc Natl Acad Sci USA, 2012, 109(40): 16184-9. doi：10.1073/pnas.1213343109
[35]	Peterson TR, Sengupta SS, Harris TE, et al. mTOR complex 1 regulates lipin 1 localization to control the SREBP pathway[J]. Cell, 2011, 146(3): 408-20. doi：10.1016/j.cell.2011.06.034
[36]	Chakrabarti P, English T, Shi J, et al. Mammalian target of rapamycin complex 1 suppresses lipolysis, stimulates lipogenesis, and promotes fat storage[J]. Diabetes, 2010, 59(4): 775-81. doi：10.2337/db09-1602
[37]	Chakrabarti P, Kim JY, Singh M, et al. Insulin inhibits lipolysis in adipocytes via the evolutionarily conserved mTORC1-Egr1-ATGL-mediated pathway[J]. Mol Cell Biol, 2013, 33(18): 3659-66. doi：10.1128/mcb.01584-12
[38]	Kim J, Kundu M, Viollet B, et al. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1[J]. Nat Cell Biol, 2011, 13(2): 132-41. doi：10.1038/ncb2152