Journal of Southern Medical University ›› 2025, Vol. 45 ›› Issue (5): 901-910.doi: 10.12122/j.issn.1673-4254.2025.05.02
Previous Articles Next Articles
Zhihua TIAN(
), Qingqing YANG, Xin CHEN, Fangfang ZHANG, Baimao ZHONG(
), Hong CAO(
)
Received:2024-12-19
Online:2025-05-20
Published:2025-05-23
Contact:
Baimao ZHONG, Hong CAO
E-mail:17837178813@163.com;zbm@dgp-institute.com;gzhcao@smu.edu.cn
Zhihua TIAN, Qingqing YANG, Xin CHEN, Fangfang ZHANG, Baimao ZHONG, Hong CAO. Spermine suppresses GBP5-mediated NLRP3 inflammasome activation in macrophages to relieve vital organ injuries in neonatal mice with enterovirus 71 infection[J]. Journal of Southern Medical University, 2025, 45(5): 901-910.
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.j-smu.com/EN/10.12122/j.issn.1673-4254.2025.05.02
| Gene | Forward (5' to 3') | Reverse (5' to 3') |
|---|---|---|
| NLRP3 | ATTACCCGCCCGAGAAAGG | CATGAGTGTGGCTAGATCCAAG |
| M-NLRP3 | ATTACCCGCCCGAGAAAGG | CATGAGTGTGGCTAGATCCAAG |
| GBP5 | CCATGTGCCTCATCGAGAACT | ACAGGTTGCGTAATGGCAGAC |
| M-GBP5 | CAGACCTATTTGAACGCCAAAGA | TGCCTTGATTCTATCAGCCTCT |
| CXCL10 | GTGGCATTCAAGGAGTACCTC | TGATGGCCTTCGATTCTGGATT |
| M-CXCL10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA |
| TNFSF10 | TGCGTGCTGATCGTGATCTTC | GCTCGTTGGTAAAGTACACGTA |
| M-TNFSF10 | ATGGTGATTTGCATAGTGCTCC | GCAAGCAGGGTCTGTTCAAGA |
| ACTIN | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
| M-ACTIN | ATGACCCAAGCCGAGAAGG | CGGCCAAGTCTTAGAGTTGTTG |
Tab.1 Primers used for qPCR
| Gene | Forward (5' to 3') | Reverse (5' to 3') |
|---|---|---|
| NLRP3 | ATTACCCGCCCGAGAAAGG | CATGAGTGTGGCTAGATCCAAG |
| M-NLRP3 | ATTACCCGCCCGAGAAAGG | CATGAGTGTGGCTAGATCCAAG |
| GBP5 | CCATGTGCCTCATCGAGAACT | ACAGGTTGCGTAATGGCAGAC |
| M-GBP5 | CAGACCTATTTGAACGCCAAAGA | TGCCTTGATTCTATCAGCCTCT |
| CXCL10 | GTGGCATTCAAGGAGTACCTC | TGATGGCCTTCGATTCTGGATT |
| M-CXCL10 | CCAAGTGCTGCCGTCATTTTC | GGCTCGCAGGGATGATTTCAA |
| TNFSF10 | TGCGTGCTGATCGTGATCTTC | GCTCGTTGGTAAAGTACACGTA |
| M-TNFSF10 | ATGGTGATTTGCATAGTGCTCC | GCAAGCAGGGTCTGTTCAAGA |
| ACTIN | CATGTACGTTGCTATCCAGGC | CTCCTTAATGTCACGCACGAT |
| M-ACTIN | ATGACCCAAGCCGAGAAGG | CGGCCAAGTCTTAGAGTTGTTG |
| siRNA | Sense (5'-3') | Antisense (5'-3') |
|---|---|---|
| NC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUCGGAGAATT |
| S1 | GCCAAAUCACACAUTT | AACUAAUGUGUGAUUUGGCTT |
| S2 | GGAAAUAGAUGGGCAACUUTT | AAGUUGCCCAUCUAUUUCCTT |
| S3 | CCAGCAAAUGGGCCAGAAATT | UUUCUGGCCCAUUUGCUGGTT |
Tab.2 GBP5 siRNA sequences
| siRNA | Sense (5'-3') | Antisense (5'-3') |
|---|---|---|
| NC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUCGGAGAATT |
| S1 | GCCAAAUCACACAUTT | AACUAAUGUGUGAUUUGGCTT |
| S2 | GGAAAUAGAUGGGCAACUUTT | AAGUUGCCCAUCUAUUUCCTT |
| S3 | CCAGCAAAUGGGCCAGAAATT | UUUCUGGCCCAUUUGCUGGTT |
Fig.1 Establishment of a mouse model of severe hand, foot and mouth disease induced by EV71 infection. A: Observation of mice on the third day following intraperitoneal EV71 injection (Left: Control group; Right: EV71 infection group). B: TOP50 differential genes with increased expression by transcriptome sequencing of the muscular tissues.
Fig.2 Pathologies in the heart, liver, lung and kidney tissue of the mice with EV71 infection. A: Histopathological examination with HE staining for assessing tissue damages. Arrows indicate the area of pathological change. B: Immunohistochemical staining for detecting the expression of F4/80 in the heart and lungs of the mice. Arrows indicate IHC positive cells for F4/80 (*P<0.05, ***P<0.0001).
Fig.3 Expressions of GBP5, NLRP, CXCL10 and TNFSF10 in neonatal mice and cultured macrophages with EV71 infection. A: Immunohistochemical staining for detecting the expression of GBP5 in the heart, liver, lung, and kidney of the mice. B-D: Western blotting and qPCR for detecting the expression of GBP5, NLRP, CXCL10 and TNFSF10 in EV71-infected mice (from left to right: heart, liver, lung and kidney) and cultured THP-1 (left) and RAW (right) cells. **P<0.001, ***P<0.0001.
Fig.4 Therapeutic effect of spermine in neonatal mouse models of severe hand, foot and mouth disease induced by EV71 infection. A: Observation of the mice on the third day following intraperitoneal injection of spermine (from left to right: control group, EV71 infection group, and spermine treatment group). B: Histopathological examination for assessing heart, liver, lung, and kidney damage in the mice in different groups (HE staining). Arrows indicate the area of pathological change. C: Immunohistochemical staining for detecting the expression of F4/80 in the heart and lung tissues. Arrows indicate IHC positive cells for F4/80. **P<0.001, ***P<0.0001.
Fig.5 Expressions of GBP5, NLRP, CXCL10 and TNFSF10 in vital organs of EV71-infected mice and in infected macrophages after spermidine treatment. A: Immunohistochemical staining for detecting the expression of GBP5 in the heart, liver, lung and kidney tissues. B-D: Western blotting and qPCR of the expressions of GBP5, NLRP, CXCL10 and TNFSF10 in EV71-infected mice and macrophages following spermine treatment. *P<0.05, **P<0.01, ***P<0.001.
Fig.6 Effect of spermine synthesis inhibition on GBP5, NLRP, CXCL10 and TNFSF10 expressions in macrophages. A: qPCR for detecting the mRNA expressions of GBP5, NLRP, CXCL10 and TNFSF10 after inhibiting GBP5 expression. ***P<0.001 vs NC. B: qPCR for examining the expressions of GBP5, NLRP, CXCL10 and TNFSF10 after inhibiting spermine synthesis. C: qPCR for examining the expressions of GBP5, NLRP, CXCL10 and TNFSF10 after inhibiting GBP5 and spermine synthesis simultaneously. ***P<0.001.
| 1 | 张 翠. 手足口病患儿的病原体研究进展[J]. 中国城乡企业卫生, 2024, 39(9): 38-40. |
| 2 | 韦欢欢, 朱俊萍, 何秋水. 手足口病主要病原变迁及分子进化研究[J]. 病毒学报, 2020, 36(5): 936-45. DOI: 10.13242/j.cnki.bingduxuebao.003704 |
| 3 | Qi ZJ, Li Z, Hao D, et al. Association between angiopoietin-2 and enterovirus 71 induced pulmonary edema[J]. Indian J Pediatr, 2016, 83(5): 391-6. |
| 4 | Zhang WJ, Huang ZG, Huang MY, et al. Predicting severe enterovirus 71-infected hand, foot, and mouth disease: cytokines and chemokines[J]. Mediators Inflamm, 2020, 2020: 9273241. |
| 5 | Hao JF, Wang H, Lu XF, et al. TLR4 signalling: the key to controlling EV71 replication and inflammatory response[J]. Front Cell Infect Microbiol, 2024, 14: 1393680. |
| 6 | Lu MY, Lin YL, Kuo YL, et al. Muscle tissue damage and recovery after EV71 infection correspond to dynamic macrophage phenotypes[J]. Front Immunol, 2021, 12: 648184. |
| 7 | Zhao DR, Guo XY, Lin BB, et al. Magnolol against enterovirus 71 by targeting Nrf2-SLC7A11-GSH pathway[J]. Biomed Pharm-acother, 2024, 176: 116866. |
| 8 | Sheu KM, Hoffmann A. Functional hallmarks of healthy macrophage responses: their regulatory basis and disease relevance[J]. Annu Rev Immunol, 2022, 40:295-321. |
| 9 | Wang HB, Lei XB, Xiao X, et al. Reciprocal regulation between enterovirus 71 and the NLRP3 inflammasome[J]. Cell Rep, 2015, 12(1): 42-8. |
| 10 | Cui J, Chen YJ, Wang HY, et al. Mechanisms and pathways of innate immune activation and regulation in health and cancer[J]. Hum Vaccin Immunother, 2014, 10(11): 3270-85. |
| 11 | Li JM, Deng HS, Yao YD, et al. Sinomenine ameliorates collagen-induced arthritis in mice by targeting GBP5 and regulating the P2X7 receptor to suppress NLRP3-related signaling pathways[J]. Acta Pharmacol Sin, 2023, 44(12): 2504-24. |
| 12 | Shenoy AR, Wellington DA, Kumar P, et al. GBP5 promotes NLRP3 inflammasome assembly and immunity in mammals[J]. Science, 2012, 336(6080): 481-5. |
| 13 | Schilperoort M, Ngai D, Sukka SR, et al. The role of efferocytosis-fueled macrophage metabolism in the resolution of inflammation[J]. Immunol Rev, 2023, 319(1):65-80. |
| 14 | Viola A, Munari F, Sánchez-Rodríguez R, et al. The metabolic sign-ature of macrophage responses[J]. Front Immunol, 2019, 10: 1462. |
| 15 | Zhang YZ, Yang QQ, Peng Q, et al. Impaired arginine/ornithine metabolism drives severe HFMD by promoting cytokine storm[J]. Front Immunol, 2024, 15: 1407035. |
| 16 | Bělíček J, Ľuptáková E, Kopečný D, et al. Biochemical and structural basis of polyamine, lysine and ornithine acetylation catalyzed by spermine/spermidine N-acetyl transferase in moss and maize[J]. Plant J, 2023, 114(3):482-98. |
| 17 | Suppola S, Heikkinen S, Parkkinen JJ, et al. Concurrent overex-pression of ornithine decarboxylase and spermidine/spermine N(1)-acetyltransferase further accelerates the catabolism of hepatic pol-yamines in transgenic mice[J]. Biochem J, 2001, 358(Pt 2): 343-8. |
| 18 | Gao YJ, Liu KY, Xiao WF, et al. Aryl hydrocarbon receptor confers protection against macrophage pyroptosis and intestinal inflammation through regulating polyamine biosynthesis[J]. Theranostics, 2024, 14(11): 4218-39. |
| 19 | Makhoba XH, Makumire S. The capture of host cell's resources: The role of heat shock proteins and polyamines in SARS-COV-2 (COVID-19) pathway to viral infection[J]. Biomol Concepts, 2022, 13(1):220-29. |
| 20 | Chang CS, Liao CC, Liou AT, et al. Enterovirus 71 targets the cardiopulmonary system in a robust oral infection mouse model[J]. Sci Rep, 2019, 9(1): 11108. |
| 21 | Abplanalp WT, Cremer S, John D, et al. Clonal hematopoiesis-driver DNMT3A mutations alter immune cells in heart failure[J]. Circ Res, 2021, 128(2): 216-28. |
| 22 | Al-Qazazi R, Lima PDA, Prisco SZ, et al. Macrophage-NLRP3 Activation Promotes Right Ventricle Failure in Pulmonary Arterial Hypertension[J]. Am J Respir Crit Care Med, 2022, 206(5):608-24. |
| 23 | Siebeler R, de Winther MPJ, Hoeksema MA. The regulatory landscape of macrophage interferon signaling in inflammation[J]. J Allergy Clin Immunol, 2023, 152(2):326-37. |
| 24 | Locati M, Curtale G, Mantovani A. Diversity, mechanisms, and significance of macrophage plasticity[J]. Annu Rev Pathol, 2020, 15: 123-47. |
| 25 | Shapouri-Moghaddam A, Mohammadian S, Vazini H, et al. Macrophage plasticity, polarization, and function in health and disease[J]. J Cell Physiol, 2018, 233(9): 6425-40. |
| 26 | Fujiwara Y, Hizukuri Y, Yamashiro K, et al. Guanylate-binding protein 5 is a marker of interferon-γ-induced classically activated macrophages[J]. Clin Transl Immunology, 2016, 5(11): e111. |
| 27 | Zhang J, Zhang YH, Chen Q, et al. The XPO1 inhibitor selinexor ameliorates bleomycin-induced pulmonary fibrosis in mice via GBP5/NLRP3 inflammasome signaling[J]. Int Immunopharmacol, 2024, 130: 111734. |
| 28 | Yang L, Chu Z, Liu M, et al. Amino acid metabolism in immune cells: essential regulators of the effector functions, and promising opportunities to enhance cancer immunotherapy[J]. J Hematol Oncol, 2023, 16(1):59. |
| 29 | Zhao HX, Raines LN, Huang SC. Carbohydrate and amino acid metabolism as hallmarks for innate immune cell activation and function[J]. Cells, 2020, 9(3): 562. |
| 30 | Cetin N, Dasdelen D, Mogulkoc R, et al. Role of exogenous putrescine in the status of energy, DNA damage, inflammation, and spermidine/spermine-n(1)‑acetyltransferase in brain ischemia-reperfusion in rats[J]. Iran J Basic Med Sci, 2022, 25(5):597-60. |
| 31 | Chen J, Rao JN, Zou TT, et al. Polyamines are required for expression of Toll-like receptor 2 modulating intestinal epithelial barrier integrity[J]. Am J Physiol Gastrointest Liver Physiol, 2007, 293(3): G568-76. |
| 32 | Jiang JT, Wang WW, Sun F, et al. Bacterial infection reinforces host metabolic flux from arginine to spermine for NLRP3 inflammasome evasion[J]. Cell Rep, 2021, 34(10): 108832. |
| [1] | Haiyi ZHOU, Siyi HE, Ruifang HAN, Yongge GUAN, Lijuan DONG, Yang SONG. Moxibustion promotes endometrial repair in rats with thin endometrium by inhibiting the NLRP3/pyroptosis axis via upregulating miR-223-3p [J]. Journal of Southern Medical University, 2025, 45(7): 1380-1388. |
| [2] | Fenlan BIAN, Shiyao NI, Peng ZHAO, Maonanxing QI, Bi TANG, Hongju WANG, Pinfang KANG, Jinjun LIU. Asiaticoside alleviates myocardial ischemia-reperfusion injury in rats by inhibiting NLRP3 inflammasome-mediated pyroptosis [J]. Journal of Southern Medical University, 2025, 45(5): 977-985. |
| [3] | Yalei SUN, Meng LUO, Changsheng GUO, Jing GAO, Kaiqi SU, Lidian CHEN, Xiaodong FENG. Amentoflavone alleviates acute lung injury in mice by inhibiting cell pyroptosis [J]. Journal of Southern Medical University, 2025, 45(4): 692-701. |
| [4] | Zhengwang ZHU, Linlin WANG, Jinghan ZHAO, Ruixue MA, Yuchun YU, Qingchun CAI, Bing WANG, Pingsheng ZHU, Mingsan MIAO. Tuihuang Mixture improves α‑naphthylisothiocyanate-induced cholestasis in rats by inhibiting NLRP3 inflammasomes via regulating farnesoid X receptor [J]. Journal of Southern Medical University, 2025, 45(4): 718-724. |
| [5] | Jinhua ZOU, Hui WANG, Dongyan ZHANG. SLC1A5 overexpression accelerates progression of hepatocellular carcinoma by promoting M2 polarization of macrophages [J]. Journal of Southern Medical University, 2025, 45(2): 269-284. |
| [6] | Wei LUO, Yuhang WANG, Yansong LIU, Yuanyuan WANG, Lei AI. High glucose induces pro-inflammatory polarization of macrophages by inhibiting immune-responsive gene 1 expression [J]. Journal of Southern Medical University, 2025, 45(1): 1-9. |
| [7] | Mingyuan LI, Wei ZHANG, Mengqing HUA. Bardoxolone methyl alleviates acute liver injury in mice by inhibiting NLRP3 inflammasome activation [J]. Journal of Southern Medical University, 2024, 44(9): 1662-1669. |
| [8] | Huaixiang TAO, Jinguang LUO, Zhiyuan WEN, Genming YU, Xiao SU, Xinwei WANG, Han GUAN, Zhijun CHEN. High STING expression exacerbates renal ischemia-reperfusion injury in mice by regulating the TLR4/NF-κB/NLRP3 pathway and promoting inflammation and apoptosis [J]. Journal of Southern Medical University, 2024, 44(7): 1345-1354. |
| [9] | Wei ZHANG, Mengmeng DENG, Yao ZENG, Chenfei LIU, Feifei SHANG, Wenhao XU, Haoyi JIANG, Fengchao WANG, Yanqing YANG. 2,6-dimethoxy-1,4-benzoquinone alleviates septic shock in mice by inhibiting NLRP3 inflammasome activation [J]. Journal of Southern Medical University, 2024, 44(6): 1024-1032. |
| [10] | Pengcheng LIU, Lijuan LOU, Xia LIU, Jian WANG, Ying JIANG. A risk scoring model based on M2 macrophage-related genes for predicting prognosis of HBV-related hepatocellular carcinoma [J]. Journal of Southern Medical University, 2024, 44(5): 827-840. |
| [11] | FANG Shangping, SUN Renke, SU Hui, ZHAI Kecheng, XIANG Yu, GAO Yangmengna, GUO Wenjun. Chlorogenic acid alleviates acute kidney injury in septic mice by inhibiting NLRP3 inflammasomes and the caspase-1 canonical pyroptosis pathway [J]. Journal of Southern Medical University, 2024, 44(2): 317-323. |
| [12] | LING Xuguang, XU Wenwen, PANG Guanlai, HONG Xuxing, LIU Fengqin, LI Yang. Tea polyphenols ameliorates acute lung injury in septic mice by inhibiting NLRP3 inflammasomes [J]. Journal of Southern Medical University, 2024, 44(2): 381-386. |
| [13] | XU Xiaohui, FENG Jinmei, LUO Ying, HE Xinyu, ZANG Jinbao, HUANG Daochao. Adeno-associated virus-mediated hepatocyte-specific NDUFA13 overexpression protects against CCl4-induced liver fibrosis in mice by inhibiting hepatic NLRP3 activation [J]. Journal of Southern Medical University, 2024, 44(2): 201-209. |
| [14] | Qi ZHANG, Zezhao JI, Abai JIASHAER∙, Youda WANG, ABUDUXUKUER∙Abulimiti. FER-1 inhibits methylglyoxal-induced ferroptosis in mouse alveolar macrophages in vitro [J]. Journal of Southern Medical University, 2024, 44(12): 2443-2448. |
| [15] | Xiuqi SUN, Jing CAI, Anbang ZHANG, Bo PANG, Chunyan CHENG, Qiqi CHA, Fei QUAN, Tao YE. Electroacupuncture pretreatment alleviates post-stroke spasticity in rats by inhibiting NF‑κB/NLRP3 signaling pathway-mediated inflammation and neuronal apoptosis [J]. Journal of Southern Medical University, 2024, 44(11): 2102-2109. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||