Spermine suppresses GBP5-mediated NLRP3 inflammasome activation in macrophages to relieve vital organ injuries in neonatal mice with enterovirus 71 infection

doi:10.12122/j.issn.1673-4254.2025.05.02

Abstract

Abstract:

Objective To observe the therapeutic effect of spermine in neonatal mouse models of severe hand, foot and mouth disease (HFMD) caused by enterovirus 71 (EV71) infection and explore its therapeutic mechanism in light of regulation of macrophage GBP5/NLRP3 inflammasome pathway. Methods Neonatal BALB/c mice (3-5 days old) were divided into control group, EV71 infection group and Spermine treatment group. The mice in the latter two groups received an intraperitoneal injection of 50 μL EV71 suspension (1×10⁶ TCID50 of EV71), followed 3 days later by intraperitoneal injection of 50 μL PBS or 100 μmol/L spermine. GBP5, NLRP3, CXCL10, and TNFSF10 expressions in heart, liver, lung and kidney tissues of the mice were detected using Western blotting and qPCR, and tissue pathologies and macrophage infiltration were assessed with HE staining and immunohistochemistry. In cultured THP-1 and RAW264.7 cells, the effects of EV71 infection, GBP5 siRNA transfection and treatment with spermine or eflornithine on GBP5, NLRP3, CXCL10, and TNFSF10 mRNA expressions were investigated using qPCR. Results In the neonatal mice, EV71 infection resulted in multiple organ damage, macrophage infiltration and activation of the GBP5/NLRP3 pathway, and spermine treatment significantly improved tissue injuries, reduced macrophage infiltration, and down-regulated the expressions of GBP5, NLRP3 and the inflammatory factors in the infected mice. In THP-1 and RAW264.7 cells, EV71 infection caused significant upregulation of GBP5, NLRP3, CXCL10, and TNFSF10 expressions, which were obviously lowered by spermine treatment. In THP-1 cells, treatment with eflornithine significantly suppressed the reduction of GBP5, NLRP3, CXCL10, and TNFSF10 expressions induced by GBP5 siRNA transfection. Conclusion Spermine suppressed EV71 infection-induced inflammatory responses by inhibiting GBP5-mediated NLRP3 inflammasome activation, suggesting a new strategy for treatment of severe HFMD.

Key words: severe hand-foot-mouth disease, enterovirus 71, NLRP3, GBP5, macrophages, spermine

Zhihua TIAN, Qingqing YANG, Xin CHEN, Fangfang ZHANG, Baimao ZHONG, Hong CAO. Spermine suppresses GBP5-mediated NLRP3 inflammasome activation in macrophages to relieve vital organ injuries in neonatal mice with enterovirus 71 infection[J]. Journal of Southern Medical University, 2025, 45(5): 901-910.

Figures/Tables 8

Tab.1 Primers used for qPCR

Gene	Forward (5' to 3')	Reverse (5' to 3')
NLRP3	ATTACCCGCCCGAGAAAGG	CATGAGTGTGGCTAGATCCAAG
M-NLRP3	ATTACCCGCCCGAGAAAGG	CATGAGTGTGGCTAGATCCAAG
GBP5	CCATGTGCCTCATCGAGAACT	ACAGGTTGCGTAATGGCAGAC
M-GBP5	CAGACCTATTTGAACGCCAAAGA	TGCCTTGATTCTATCAGCCTCT
CXCL10	GTGGCATTCAAGGAGTACCTC	TGATGGCCTTCGATTCTGGATT
M-CXCL10	CCAAGTGCTGCCGTCATTTTC	GGCTCGCAGGGATGATTTCAA
TNFSF10	TGCGTGCTGATCGTGATCTTC	GCTCGTTGGTAAAGTACACGTA
M-TNFSF10	ATGGTGATTTGCATAGTGCTCC	GCAAGCAGGGTCTGTTCAAGA
ACTIN	CATGTACGTTGCTATCCAGGC	CTCCTTAATGTCACGCACGAT
M-ACTIN	ATGACCCAAGCCGAGAAGG	CGGCCAAGTCTTAGAGTTGTTG

Tab.2 GBP5 siRNA sequences

siRNA	Sense (5'-3')	Antisense (5'-3')
NC	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUCGGAGAATT
S1	GCCAAAUCACACAUTT	AACUAAUGUGUGAUUUGGCTT
S2	GGAAAUAGAUGGGCAACUUTT	AAGUUGCCCAUCUAUUUCCTT
S3	CCAGCAAAUGGGCCAGAAATT	UUUCUGGCCCAUUUGCUGGTT

Fig.1 Establishment of a mouse model of severe hand, foot and mouth disease induced by EV71 infection. A: Observation of mice on the third day following intraperitoneal EV71 injection (Left: Control group; Right: EV71 infection group). B: TOP50 differential genes with increased expression by transcriptome sequencing of the muscular tissues.

Fig.2 Pathologies in the heart, liver, lung and kidney tissue of the mice with EV71 infection. A: Histopathological examination with HE staining for assessing tissue damages. Arrows indicate the area of pathological change. B: Immunohistochemical staining for detecting the expression of F4/80 in the heart and lungs of the mice. Arrows indicate IHC positive cells for F4/80 (*P<0.05, ***P<0.0001).

Fig.3 Expressions of GBP5, NLRP, CXCL10 and TNFSF10 in neonatal mice and cultured macrophages with EV71 infection. A: Immunohistochemical staining for detecting the expression of GBP5 in the heart, liver, lung, and kidney of the mice. B-D: Western blotting and qPCR for detecting the expression of GBP5, NLRP, CXCL10 and TNFSF10 in EV71-infected mice (from left to right: heart, liver, lung and kidney) and cultured THP-1 (left) and RAW (right) cells. **P<0.001, ***P<0.0001.

Fig.4 Therapeutic effect of spermine in neonatal mouse models of severe hand, foot and mouth disease induced by EV71 infection. A: Observation of the mice on the third day following intraperitoneal injection of spermine (from left to right: control group, EV71 infection group, and spermine treatment group). B: Histopathological examination for assessing heart, liver, lung, and kidney damage in the mice in different groups (HE staining). Arrows indicate the area of pathological change. C: Immunohistochemical staining for detecting the expression of F4/80 in the heart and lung tissues. Arrows indicate IHC positive cells for F4/80. **P<0.001, ***P<0.0001.

Fig.5 Expressions of GBP5, NLRP, CXCL10 and TNFSF10 in vital organs of EV71-infected mice and in infected macrophages after spermidine treatment. A: Immunohistochemical staining for detecting the expression of GBP5 in the heart, liver, lung and kidney tissues. B-D: Western blotting and qPCR of the expressions of GBP5, NLRP, CXCL10 and TNFSF10 in EV71-infected mice and macrophages following spermine treatment. *P<0.05, **P<0.01, ***P<0.001.

Fig.6 Effect of spermine synthesis inhibition on GBP5, NLRP, CXCL10 and TNFSF10 expressions in macrophages. A: qPCR for detecting the mRNA expressions of GBP5, NLRP, CXCL10 and TNFSF10 after inhibiting GBP5 expression. ***P<0.001 vs NC. B: qPCR for examining the expressions of GBP5, NLRP, CXCL10 and TNFSF10 after inhibiting spermine synthesis. C: qPCR for examining the expressions of GBP5, NLRP, CXCL10 and TNFSF10 after inhibiting GBP5 and spermine synthesis simultaneously. ***P<0.001.

References 32

1	张翠. 手足口病患儿的病原体研究进展[J]. 中国城乡企业卫生, 2024, 39(9): 38-40.
2	韦欢欢, 朱俊萍, 何秋水. 手足口病主要病原变迁及分子进化研究[J]. 病毒学报, 2020, 36(5): 936-45. DOI: 10.13242/j.cnki.bingduxuebao.003704
3	Qi ZJ, Li Z, Hao D, et al. Association between angiopoietin-2 and enterovirus 71 induced pulmonary edema[J]. Indian J Pediatr, 2016, 83(5): 391-6.
4	Zhang WJ, Huang ZG, Huang MY, et al. Predicting severe enterovirus 71-infected hand, foot, and mouth disease: cytokines and chemokines[J]. Mediators Inflamm, 2020, 2020: 9273241.
5	Hao JF, Wang H, Lu XF, et al. TLR4 signalling: the key to controlling EV71 replication and inflammatory response[J]. Front Cell Infect Microbiol, 2024, 14: 1393680.
6	Lu MY, Lin YL, Kuo YL, et al. Muscle tissue damage and recovery after EV71 infection correspond to dynamic macrophage phenotypes[J]. Front Immunol, 2021, 12: 648184.
7	Zhao DR, Guo XY, Lin BB, et al. Magnolol against enterovirus 71 by targeting Nrf2-SLC7A11-GSH pathway[J]. Biomed Pharm-acother, 2024, 176: 116866.
8	Sheu KM, Hoffmann A. Functional hallmarks of healthy macrophage responses: their regulatory basis and disease relevance[J]. Annu Rev Immunol, 2022, 40:295-321.
9	Wang HB, Lei XB, Xiao X, et al. Reciprocal regulation between enterovirus 71 and the NLRP3 inflammasome[J]. Cell Rep, 2015, 12(1): 42-8.
10	Cui J, Chen YJ, Wang HY, et al. Mechanisms and pathways of innate immune activation and regulation in health and cancer[J]. Hum Vaccin Immunother, 2014, 10(11): 3270-85.
11	Li JM, Deng HS, Yao YD, et al. Sinomenine ameliorates collagen-induced arthritis in mice by targeting GBP5 and regulating the P2X7 receptor to suppress NLRP3-related signaling pathways[J]. Acta Pharmacol Sin, 2023, 44(12): 2504-24.
12	Shenoy AR, Wellington DA, Kumar P, et al. GBP5 promotes NLRP3 inflammasome assembly and immunity in mammals[J]. Science, 2012, 336(6080): 481-5.
13	Schilperoort M, Ngai D, Sukka SR, et al. The role of efferocytosis-fueled macrophage metabolism in the resolution of inflammation[J]. Immunol Rev, 2023, 319(1):65-80.
14	Viola A, Munari F, Sánchez-Rodríguez R, et al. The metabolic sign-ature of macrophage responses[J]. Front Immunol, 2019, 10: 1462.
15	Zhang YZ, Yang QQ, Peng Q, et al. Impaired arginine/ornithine metabolism drives severe HFMD by promoting cytokine storm[J]. Front Immunol, 2024, 15: 1407035.
16	Bělíček J, Ľuptáková E, Kopečný D, et al. Biochemical and structural basis of polyamine, lysine and ornithine acetylation catalyzed by spermine/spermidine N-acetyl transferase in moss and maize[J]. Plant J, 2023, 114(3):482-98.
17	Suppola S, Heikkinen S, Parkkinen JJ, et al. Concurrent overex-pression of ornithine decarboxylase and spermidine/spermine N(1)-acetyltransferase further accelerates the catabolism of hepatic pol-yamines in transgenic mice[J]. Biochem J, 2001, 358(Pt 2): 343-8.
18	Gao YJ, Liu KY, Xiao WF, et al. Aryl hydrocarbon receptor confers protection against macrophage pyroptosis and intestinal inflammation through regulating polyamine biosynthesis[J]. Theranostics, 2024, 14(11): 4218-39.
19	Makhoba XH, Makumire S. The capture of host cell's resources: The role of heat shock proteins and polyamines in SARS-COV-2 (COVID-19) pathway to viral infection[J]. Biomol Concepts, 2022, 13(1):220-29.
20	Chang CS, Liao CC, Liou AT, et al. Enterovirus 71 targets the cardiopulmonary system in a robust oral infection mouse model[J]. Sci Rep, 2019, 9(1): 11108.
21	Abplanalp WT, Cremer S, John D, et al. Clonal hematopoiesis-driver DNMT3A mutations alter immune cells in heart failure[J]. Circ Res, 2021, 128(2): 216-28.
22	Al-Qazazi R, Lima PDA, Prisco SZ, et al. Macrophage-NLRP3 Activation Promotes Right Ventricle Failure in Pulmonary Arterial Hypertension[J]. Am J Respir Crit Care Med, 2022, 206(5):608-24.
23	Siebeler R, de Winther MPJ, Hoeksema MA. The regulatory landscape of macrophage interferon signaling in inflammation[J]. J Allergy Clin Immunol, 2023, 152(2):326-37.
24	Locati M, Curtale G, Mantovani A. Diversity, mechanisms, and significance of macrophage plasticity[J]. Annu Rev Pathol, 2020, 15: 123-47.
25	Shapouri-Moghaddam A, Mohammadian S, Vazini H, et al. Macrophage plasticity, polarization, and function in health and disease[J]. J Cell Physiol, 2018, 233(9): 6425-40.
26	Fujiwara Y, Hizukuri Y, Yamashiro K, et al. Guanylate-binding protein 5 is a marker of interferon-γ-induced classically activated macrophages[J]. Clin Transl Immunology, 2016, 5(11): e111.
27	Zhang J, Zhang YH, Chen Q, et al. The XPO1 inhibitor selinexor ameliorates bleomycin-induced pulmonary fibrosis in mice via GBP5/NLRP3 inflammasome signaling[J]. Int Immunopharmacol, 2024, 130: 111734.
28	Yang L, Chu Z, Liu M, et al. Amino acid metabolism in immune cells: essential regulators of the effector functions, and promising opportunities to enhance cancer immunotherapy[J]. J Hematol Oncol, 2023, 16(1):59.
29	Zhao HX, Raines LN, Huang SC. Carbohydrate and amino acid metabolism as hallmarks for innate immune cell activation and function[J]. Cells, 2020, 9(3): 562.
30	Cetin N, Dasdelen D, Mogulkoc R, et al. Role of exogenous putrescine in the status of energy, DNA damage, inflammation, and spermidine/spermine-n(1)‑acetyltransferase in brain ischemia-reperfusion in rats[J]. Iran J Basic Med Sci, 2022, 25(5):597-60.
31	Chen J, Rao JN, Zou TT, et al. Polyamines are required for expression of Toll-like receptor 2 modulating intestinal epithelial barrier integrity[J]. Am J Physiol Gastrointest Liver Physiol, 2007, 293(3): G568-76.
32	Jiang JT, Wang WW, Sun F, et al. Bacterial infection reinforces host metabolic flux from arginine to spermine for NLRP3 inflammasome evasion[J]. Cell Rep, 2021, 34(10): 108832.

[1]	Haiyi ZHOU, Siyi HE, Ruifang HAN, Yongge GUAN, Lijuan DONG, Yang SONG. Moxibustion promotes endometrial repair in rats with thin endometrium by inhibiting the NLRP3/pyroptosis axis via upregulating miR-223-3p [J]. Journal of Southern Medical University, 2025, 45(7): 1380-1388.
[2]	Fenlan BIAN, Shiyao NI, Peng ZHAO, Maonanxing QI, Bi TANG, Hongju WANG, Pinfang KANG, Jinjun LIU. Asiaticoside alleviates myocardial ischemia-reperfusion injury in rats by inhibiting NLRP3 inflammasome-mediated pyroptosis [J]. Journal of Southern Medical University, 2025, 45(5): 977-985.
[3]	Yalei SUN, Meng LUO, Changsheng GUO, Jing GAO, Kaiqi SU, Lidian CHEN, Xiaodong FENG. Amentoflavone alleviates acute lung injury in mice by inhibiting cell pyroptosis [J]. Journal of Southern Medical University, 2025, 45(4): 692-701.
[4]	Zhengwang ZHU, Linlin WANG, Jinghan ZHAO, Ruixue MA, Yuchun YU, Qingchun CAI, Bing WANG, Pingsheng ZHU, Mingsan MIAO. Tuihuang Mixture improves α‑naphthylisothiocyanate-induced cholestasis in rats by inhibiting NLRP3 inflammasomes via regulating farnesoid X receptor [J]. Journal of Southern Medical University, 2025, 45(4): 718-724.
[5]	Jinhua ZOU, Hui WANG, Dongyan ZHANG. SLC1A5 overexpression accelerates progression of hepatocellular carcinoma by promoting M2 polarization of macrophages [J]. Journal of Southern Medical University, 2025, 45(2): 269-284.
[6]	Wei LUO, Yuhang WANG, Yansong LIU, Yuanyuan WANG, Lei AI. High glucose induces pro-inflammatory polarization of macrophages by inhibiting immune-responsive gene 1 expression [J]. Journal of Southern Medical University, 2025, 45(1): 1-9.
[7]	Mingyuan LI, Wei ZHANG, Mengqing HUA. Bardoxolone methyl alleviates acute liver injury in mice by inhibiting NLRP3 inflammasome activation [J]. Journal of Southern Medical University, 2024, 44(9): 1662-1669.
[8]	Huaixiang TAO, Jinguang LUO, Zhiyuan WEN, Genming YU, Xiao SU, Xinwei WANG, Han GUAN, Zhijun CHEN. High STING expression exacerbates renal ischemia-reperfusion injury in mice by regulating the TLR4/NF-κB/NLRP3 pathway and promoting inflammation and apoptosis [J]. Journal of Southern Medical University, 2024, 44(7): 1345-1354.
[9]	Wei ZHANG, Mengmeng DENG, Yao ZENG, Chenfei LIU, Feifei SHANG, Wenhao XU, Haoyi JIANG, Fengchao WANG, Yanqing YANG. 2,6-dimethoxy-1,4-benzoquinone alleviates septic shock in mice by inhibiting NLRP3 inflammasome activation [J]. Journal of Southern Medical University, 2024, 44(6): 1024-1032.
[10]	Pengcheng LIU, Lijuan LOU, Xia LIU, Jian WANG, Ying JIANG. A risk scoring model based on M2 macrophage-related genes for predicting prognosis of HBV-related hepatocellular carcinoma [J]. Journal of Southern Medical University, 2024, 44(5): 827-840.
[11]	FANG Shangping, SUN Renke, SU Hui, ZHAI Kecheng, XIANG Yu, GAO Yangmengna, GUO Wenjun. Chlorogenic acid alleviates acute kidney injury in septic mice by inhibiting NLRP3 inflammasomes and the caspase-1 canonical pyroptosis pathway [J]. Journal of Southern Medical University, 2024, 44(2): 317-323.
[12]	LING Xuguang, XU Wenwen, PANG Guanlai, HONG Xuxing, LIU Fengqin, LI Yang. Tea polyphenols ameliorates acute lung injury in septic mice by inhibiting NLRP3 inflammasomes [J]. Journal of Southern Medical University, 2024, 44(2): 381-386.
[13]	XU Xiaohui, FENG Jinmei, LUO Ying, HE Xinyu, ZANG Jinbao, HUANG Daochao. Adeno-associated virus-mediated hepatocyte-specific NDUFA13 overexpression protects against CCl4-induced liver fibrosis in mice by inhibiting hepatic NLRP3 activation [J]. Journal of Southern Medical University, 2024, 44(2): 201-209.
[14]	Qi ZHANG, Zezhao JI, Abai JIASHAER∙, Youda WANG, ABUDUXUKUER∙Abulimiti. FER-1 inhibits methylglyoxal-induced ferroptosis in mouse alveolar macrophages in vitro [J]. Journal of Southern Medical University, 2024, 44(12): 2443-2448.
[15]	Xiuqi SUN, Jing CAI, Anbang ZHANG, Bo PANG, Chunyan CHENG, Qiqi CHA, Fei QUAN, Tao YE. Electroacupuncture pretreatment alleviates post-stroke spasticity in rats by inhibiting NF‑κB/NLRP3 signaling pathway-mediated inflammation and neuronal apoptosis [J]. Journal of Southern Medical University, 2024, 44(11): 2102-2109.