Lycium barbarum glycopeptide reduces bone loss caused by exosomes derived from human gingival fibroblasts with radiation exposure

doi:10.12122/j.issn.1673-4254.2024.09.15

Abstract

Abstract:

Objective To explore the protective effect of Lycium barbanun glycopeptide (LbGP) against osteogenic inhibition induced by exosomes derived from human gingival fibroblasts (HGFs) exposed to radiation. Methods Cultured HGFs with or without LbGP pretreatment were exposed to 8 Gy X-ray radiation, and the changes in cell apoptosis, senescence and α-SMA level were detected using RT-qPCR, Western blotting and β-galactosidase staining. The exosomes secreted by the treated cells were extracted, and after identification by electron microscopy, particle size analysis and Western blotting, the exosomes were added into primary cultured bone mesenchymal stem cells (BMSCs), and osteoclast activity and osteogenesis in the cell cultures were detected by Trap staining, Alizarin red staining, ALP staining, RT-qPCR and Western blotting. Results In cultured HGFs, X-ray radiation significantly increased the percentage of senescent cells, which was obviously lowered by LbGP treatment. X-ray radiation significantly reduced Bcl-2/Bax ratio and increased α-SMA expression in HGFs, and these changes were significantly suppressed by LbGP pretreatment. In rat BMSCs, incubation with the exosomes derived from HGFs with radiation exposure caused a significant increase of osteoclasts, reduced calcium nodules and lowered alkaline phosphatase expression in the cells; The opposite changes were observed in the cells treated with exosomes from LbGP-pretreated HGFs, which also significantly increased the cellular expressions of the osteogenic genes (BMP2, ALP, and RUNX2) and proteins (ALP and RUNX2) as compared with the exosomes from irradiated HGFs. Conclusion LbGP can effectively inhibit osteoclast activity and promote osteogenesis by acting on exosomes secreted by irradiated HGFs, suggesting its potential value for treatment of osteoradionecrosis of the jaw.

Key words: Lycium barbarum glycopeptide, exosomes, osteoradionecrosis of the jaw, osteogenic differentiation

Siqi HE, Nan WEN, Xun CHEN, Yue WANG, Tin ZHANG, Yandong MU. Lycium barbarum glycopeptide reduces bone loss caused by exosomes derived from human gingival fibroblasts with radiation exposure[J]. Journal of Southern Medical University, 2024, 44(9): 1752-1759.

Figures/Tables 6

Tab.1 Primer sequences

Genes

Sequence primers (5'→3')

GAPDH-F

GAPDH-R

BMP2-F

BMP2-R

ALP-F

ALP-R

RUNX2-R

RUNX2-F

CCTCGTCTCATAGACAAGATGGT

GGGTAGAGTCATACTGGAACATG

CTATATGCTCGACCTGTACCG

CACTCATTTCTGAAAGTTCCTCG

CAGAGAAAGAGAAAGACCCCAG

CTGTCACTGTGGAGACGC

AAGAGGGGTAAGACTGGTCATAGG

CAGTATGAGAGTAGGTGTCCCGC

Fig.1 Identification of human gingival fibroblasts (HGFs) and rat bone mesenchymal stem cells (BMSCs). A: Morphology of HGFs under optical microscope (a) and immunocytochemical staining showing positive expression of anti-vimentin (b) and negative expression of anti-ck8 (c) in HGFs. B: Morphology of BMSCs under optical microscopy (a) and identification of BMSCs surface markers by flow cytometry (b).

Fig.2 Characterization of HGFs with X-ray radiation and Lycium barbanun glycopeptide (LbGP) treatment. A: β-galactosidase staining. B: Relative protein expression of Bcl-2 and Bax in each group. C: Relative protein expression of α-SMA in each group. *P<0.05,**P<0.01, ****P<0.0001.

Fig.3 Identification of the exosomes derived from HGFs.A: Electron microscopy for observing structure of the exosomes. B: Exosome particle size analysis. C: Exosome concentration distribution map. D: Western blotting for detecting exosomes surface markers CD81 and Tsg101. E: Exosomes under confocal microscope.

Fig.4 Osteoblast and osteogenic staining results of rat BMSCs treated with exosomes from HGFs in different groups. A: Optical microscopy of the osteoclasts and Trap staining. B: Alizarin red staining. C: ALP staining.

Fig.5 Expression of osteogenesis-related factors in BMSCs treated with exosomes from HGFs in different groups. A: Relative mRNA expression of BMP2, ALP, and RUNX2 in BMSCs in each group. B: Relative protein expressions of RUNX2 and ALP in each group. *P<0.05, **P<0.01, ***P<0.001, ***P<0.0001.

References 30

1	Zhang R, Wang ZL, Zhu GX, et al. Low-intensity pulsed ultrasound modulates RhoA/ROCK signaling of rat mandibular bone marrow mesenchymal stem cells to rescue their damaged cytoskeletal organization and cell biological function induced by radiation[J]. Stem Cells Int, 2020, 2020: 8863577-86.
2	De Felice F, Tombolini V, Musio D, et al. Radiation therapy and mandibular osteoradionecrosis: state of the art[J]. Curr Oncol Rep, 2020, 22(9): 89.
3	Gallego L, Junquera L, García-Consuegra L, et al. Regeneration of mandibular osteoradionecrosis with autologous cross-linked serum albumin scaffold[J]. Regen Med, 2020, 15(7): 1841-9.
4	Lajolo C, Rupe C, Gioco G, et al. Osteoradionecrosis of the jaws due to teeth extractions during and after radiotherapy: a systematic review[J]. Cancers, 2021, 13(22): 5798.
5	Jacobson AS, Buchbinder D, Hu K, et al. Paradigm shifts in the management of osteoradionecrosis of the mandible[J]. Oral Oncol, 2010, 46(11): 795-801.
6	Frankart AJ, Frankart MJ, Cervenka B, et al. Osteoradionecrosis: exposing the evidence not the bone[J]. Int J Radiat Oncol Biol Phys, 2021, 109(5): 1206-18.
7	Zhuang XM, Zhou B. Exosome secreted by human gingival fibroblasts in radiation therapy inhibits osteogenic differentiation of bone mesenchymal stem cells by transferring miR-23a[J]. Biomed Pharmacother, 2020, 131: 110672.
8	Gundestrup AK, Lynggaard CD, Forner L, et al. Mesenchymal stem cell therapy for osteoradionecrosis of the mandible: a systematic review of preclinical and human studies[J]. Stem Cell Rev Rep, 2020, 16(6): 1208-21.
9	Tenchov R, Sasso JM, Wang XM, et al. Exosomes-Nature's lipid nanoparticles, a rising star in drug delivery and diagnostics[J]. ACS Nano, 2022, 16(11): 17802-46.
10	Tang YF, Sun YQ, Zeng JK, et al. Exosomal miR-140-5p inhibits osteogenesis by targeting IGF1R and regulating the mTOR pathway in ossification of the posterior longitudinal ligament[J]. J Nanobiotechnology, 2022, 20(1): 452.
11	Zha Y, Li YW, Lin TY, et al. Progenitor cell-derived exosomes endowed with VEGF plasmids enhance osteogenic induction and vascular remodeling in large segmental bone defects[J]. Theranostics, 2021, 11(1): 397-409.
12	Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes[J]. Science, 2020, 367(6478): eaau6977-90.
13	Ho YS, Yu MS, Lai CSW, et al. Characterizing the neuroprotective effects of alkaline extract of Lycium barbarum on beta-amyloid peptide neurotoxicity[J]. Brain Res, 2007, 1158: 123-34.
14	Sun WL, Shahrajabian MH, Cheng Q. Health benefits of wolfberry (Gou Qi Zi, Fructus barbarum L.) on the basis of ancient Chineseherbalism and Western modern medicine[J]. Avicenna J Phytomed, 2021, 11(2): 109-19.
15	Jiang SJ, Xiao X, Li J, et al. Lycium barbarum polysaccharide-glycoprotein ameliorates ionizing radiation-induced epithelial injury by regulating oxidative stress and ferroptosis via the Nrf2 pathway[J]. Free Radic Biol Med, 2023, 204: 84-94.
16	Wu JX, Chen T, Wan FQ, et al. Structural characterization of a polysaccharide from Lycium barbarum and its neuroprotective effect against β-amyloid peptide neurotoxicity[J]. Int J Biol Macromol, 2021, 176: 352-63.
17	Xiao Y, Chen WH, Chen RX, et al. Exosomal microRNA expression profiling analysis of the effects of Lycium barbarum polysaccharide on gestational diabetes mellitus mice[J]. Evid Based Complement Alternat Med, 2020, 2020: 2953502.
18	Chen H, Liu ZL, Yue K, et al. Immune microenvironment: novel perspectives on bone regeneration disorder in osteoradionecrosis of the jaws[J]. Cell Tissue Res, 2023, 392(2): 413-30.
19	Delanian S, Lefaix JL. The radiation-induced fibroatrophic process: therapeutic perspective via the antioxidant pathway[J]. Radiother Oncol, 2004, 73(2): 119-31.
20	Lyons A, Ghazali N. Osteoradionecrosis of the jaws: current understanding of its pathophysiology and treatment[J]. Br J Oral Maxillofac Surg, 2008, 46(8): 653-60.
21	Singh S, Kloss FR, Brunauer R, et al. Mesenchymal stem cells show radioresistance in vivo [J]. J Cell Mol Med, 2012, 16(4): 877-87.
22	De Felice F, Tombolini V, Musio D, et al. Radiation therapy and mandibular osteoradionecrosis: state of the art[J]. Curr Oncol Rep, 2020, 22(9): 89.
23	Jiang YH, Jahagirdar BN, Reinhardt RL, et al. Erratum: Pluripotency of mesenchymal stem cells derived from adult marrow[J]. Nature, 2007, 447: 880-1.
24	Li J, Yin P, Chen XY, et al. Effect of α2-macroglobulin in the early stage of jaw osteoradionecrosis[J]. Int J Oncol, 2020, 57(1): 213-22.
25	Song Q, Yong HM, Yang LL, et al. Lycium barbarum polysaccharide protects against osteonecrosis of femoral head via regulating Runx2 expression[J]. Injury, 2022, 53(4): 1361-7.
26	Liu JF, Li YC, Pu QS, et al. A polysaccharide from Lycium barbarum L.: structure and protective effects against oxidative stress and high-glucose-induced apoptosis in ARPE-19 cells[J]. Int J Biol Macromol, 2022, 201: 111-20.
27	Sun CX, Chen X, Yang SP, et al. LBP1C-2 from Lycium barbarum alleviated age-related bone loss by targeting BMPRIA/BMPRII/Noggin[J]. Carbohydr Polym, 2023, 310: 120725.
28	Lai S, Liu C, Liu C, et al. Lycium barbarum polysaccharide-glycoprotein promotes osteogenesis in hPDLSCs via ERK activation[J]. Oral Dis, 2023, 29(8): 3503-13.
29	Zha Y, Li YW, Lin TY, et al. Progenitor cell-derived exosomes endowed with VEGF plasmids enhance osteogenic induction and vascular remodeling in large segmental bone defects[J]. Theranostics, 2021, 11(1): 397-409.
30	Zhao ZK, Yu HL, Liu B, et al. Antioxidative mechanism of Lycium barbarum polysaccharides promotes repair and regeneration following cavernous nerve injury[J]. Neural Regen Res, 2016, 11(8): 1312-21.

[1]	Shuyu TU, Xiangyu CHEN, Chenghui LI, Danping HUANG, Li ZHANG. Buyang Huanwu Decoction delays vascular aging in rats through exosomal miR-590-5p signal-mediated macrophage polarization [J]. Journal of Southern Medical University, 2025, 45(6): 1251-1259.
[2]	Zhiliang CHEN, Yonggang YANG, Xia HUANG, Yan CHENG, Yuan QU, Qiqi HENG, Yujia FU, Kewei LI, Ning GU. Differential expressions of exosomal miRNAs in patients with chronic heart failure and hyperuricemia: diagnostic values of miR-27a-5p and miR-139-3p [J]. Journal of Southern Medical University, 2025, 45(1): 43-51.
[3]	Rong DAI, Zeping CAO, Chuanjiao LIU, Yong GE, Meng CHENG, Weili WANG, Yizhen CHEN, Lei ZHANG, Yiping WANG. Qingshen Granules alleviates renal fibrosis in mice by regulating exosomes, miR-330-3p, and CREBBP expression [J]. Journal of Southern Medical University, 2024, 44(8): 1431-1440.
[4]	Zhiyong KE, Zicheng HUANG, Ruolin HE, Qian ZHANG, Sixu CHEN, Zhong-Kai CUI, Jing DING. Hmga2 knockdown enhances osteogenic differentiation of adipose-derived mesenchymal stem cells and accelerates bone defect healing in mice [J]. Journal of Southern Medical University, 2024, 44(7): 1227-1235.
[5]	Guangya CHEN, Xingliang XIANG, Zhaoxiang ZENG, Rongzeng HUANG, Shuna JIN, Mingzhong XIAO, Chengwu SONG. Regulatory effect of Diwu Yanggan Decoction on lysoglycerophospholipids in circulating exosomes in a mouse model of nonalcoholic fatty liver disease [J]. Journal of Southern Medical University, 2024, 44(7): 1382-1388.
[6]	Tong YUAN, Yuying GUO, Junling ZHANG, Saijun FAN. Normal mouse serum alleviates radiation pneumonitis in mice by inhibiting the focal adhesion signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 801-809.
[7]	Fenxia LI, Haosheng LIN, Yilin LI, Wenqian ZHU, Yuanjie SUN, Yuan HUANG, Yuwen QIU, Xia QIN, Qingxian CHANG. Differential expression profile of miRNAs in maternal amniotic fluid exosomes in fetuses with isolated ventriculomegaly [J]. Journal of Southern Medical University, 2024, 44(11): 2256-2264.
[8]	SUN Xiaopeng, SHI Hang, ZHANG Lei, LIU Zhong, LI Kewei, QIAN Lingling, ZHU Xingyu, YANG Kangjia, FU Qiang, DING Hua. Exosomes from ectoderm mesenchymal stem cells inhibits lipopolysaccharide-induced microglial M1 polarization and promotes survival of H₂O₂-exposed PC12 cells by suppressing inflammatory response and oxidative stress [J]. Journal of Southern Medical University, 2024, 44(1): 119-128.
[9]	CHEN Weiren, DU Hui, SHA Yuan, ZHOU Yujie, LIANG Jing, CHEN Yundai, MA Qian, WU Xueping, QIAN Geng. Long noncoding RNA H19 promotes vascular calcification by repressing the Bax inhibitor 1/optic atrophy 1 pathway [J]. Journal of Southern Medical University, 2023, 43(9): 1469-1475.
[10]	HE Yanjuan, LI Zhuoyi, SHEN Lin, SHI Dinghua, LI Shentang. Cardiac progenitor cells-derived exosomes alleviate myocardial injury by regulating Treg cell differentiation through the mTOR pathway in mice with myocardial infarction [J]. Journal of Southern Medical University, 2023, 43(9): 1644-1650.
[11]	XU Mengqi, SHI Yutong, LIU Junping, WU Minmin, ZHANG Fengmei, HE Zhiqiang, TANG Min. JAG1 affects monocytes-macrophages to reshape the pre-metastatic niche of triple-negative breast cancer through LncRNA MALAT1 in exosomes [J]. Journal of Southern Medical University, 2023, 43(9): 1525-1535.
[12]	CHEN Zifeng, LI Shengfa, ZHANG Youming, YANG Wanwen, WANG Ting. Lipocalin 2 induces self- limited inhibition of osteoblast differentiation of mesenchymal stem cells [J]. Journal of Southern Medical University, 2023, 43(8): 1339-1344.
[13]	WANG Li, YAN Zhirui, XIA Yaoxiong. Silencing RAB27a inhibits proliferation, invasion and adhesion of triple-negative breast cancer cells [J]. Journal of Southern Medical University, 2023, 43(4): 560-567.
[14]	LIU Yu, ZENG Lian, WANG Weihong, YANG Yanling, WANG Zhou, LIU Jianqi, LI Wei, SUN Jingyu, YU Xiaohong. Human bone marrow mesenchymal stem cell exosome-derived miR-335-5p promotes osteogenic differentiation of human periodontal ligament stem cells to alleviate periodontitis by downregulating DKK1 [J]. Journal of Southern Medical University, 2023, 43(3): 420-427.
[15]	ZHANG Mengying, LI Zhi, PEI Weiya, LI Xueqin, YANG Hui, ZHU Xiaolong, LÜ Kun. M2 macrophage-derived exosomal lncRNA NR_028113.1 promotes macrophage polarization possibly by activating the JAK2/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2023, 43(3): 393-399.