Streptococcus salivarius-derived extracellular vesicles exacerbate progression of lupus nephritis by activating natural killer cells

doi:10.12122/j.issn.1673-4254.2026.03.08

Abstract

Abstract:

Objective To investigate the regulatory effects of Streptococcus salivarius-derived extracellular vesicles (SS-EVs) on natural killer (NK) cell activation and cytotoxic function and their role in progression of systemic lupus erythematosus (SLE). Methods Peripheral blood and fecal samples were collected from 35 SLE patients and 38 healthy individuals to assess the number and proportion of peripheral T cells, B cells, and NK cells. Fecal DNA was extracted for PCR amplification of S. salivarius DNA fragments and quantitative analysis using agarose gel electrophoresis. SS-EVs isolated by ultracentrifugation and characterized using transmission electron microscopy, nanoparticle tracking analysis, and Western blotting were co-cultured with NK cells, whose activation status and cytotoxicity were evaluated in vitro using qPCR and flow cytometry. Twenty-four MRL/lpr mice were randomized into 3 groups (n=8) for treatment with gavage of 100 μL PBS or 20 μg E. coli-EVs or SS-EVs in 100 μL PBS. Kidney pathology, immune complex deposition, and peripheral cytokine levels were assessed with HE staining, immunofluorescence staining, and ELISA. Results The number and proportion of peripheral NK cells were significantly reduced (P<0.0001) and the fecal abundance of S. salivarius was markedly increased in positive correlation with SLEDAI scores (R²=0.8369) in SLE patients. In vitro studies showed that SS-EVs significantly upregulated NK cell-activating receptors and enhanced NK-mediated cytotoxicity. In MRL/lpr mice, SS-EV treatment markedly exacerbated renal inflammation, promoted C3 and IgG immune complex deposition, and significantly increased serum levels of IL-6, TNF-α, IL-8, and CCL20. Conclusion S. salivarius is enriched in the gut of SLE patients and promotes NK-cell activation by releasing SS-EVs, which induce renal inflammation and immune complex deposition and contributes to SLE progression. S. salivarius and its EVs may represent novel therapeutic targets for treatment of SLE.

Key words: systemic lupus erythematosus, Streptococcus salivarius, extracellular vesicles, natural killer cells, immunomodulation

Jie XIAO, Lingyue JIN, Lina DUAN, Ying GONG, Haixia LI. Streptococcus salivarius-derived extracellular vesicles exacerbate progression of lupus nephritis by activating natural killer cells[J]. Journal of Southern Medical University, 2026, 46(3): 541-549.

Figures/Tables 7

Tab.1 Primer sequences for qPCR

Primer name	Sequence (5'-3')
GAPDH -FOR	CTGTTCGACAGTCAGCCGCATC
GAPDH -REV	GCGCCCAATACGACCAAATCCG
TNF-FOR	GAGGCCAAGCCCTGGTATG
TNF-REV	CGGGCCGATTGATCTCAGC
GZMB-FOR	CCCTGGGAAAACACTCACACA
GZMB-REV	GCACAACTCAATGGTACTGTCG
IL2-FOR	AACTCCTGTCTTGCATTGCAC
IL2-REV	GCTCCAGTTGTAGCTGTGTTT
Perforin-FOR	GACTGCCTGACTGTCGAGG
Perforin-REV	TCCCGGTAGGTTTGGTGGAA
NKG2D-FOR	CCTTGACCGAAAGTTACTGTGG
NKG2D-REV	GGCTGGCATTTTGAGACATACAA
NKG2A-FOR	AGCTCCATTTTAGCAACTGAACA
NKG2A-REV	CAACTATCGTTACCACAGAGGC

Tab.2 Clinical characteristics of the SLE patients and healthy control subjects (Mean±SD)

General information		SLE group (n=35)	HC group (n=38)	P
Gender [n (%)]	Female	30 (85.71%)	31 (81.58%)	0.756
Gender [n (%)]	Male	5 (14.29%)	7 (18.42%)	0.756
Age (year)		36.57±12.50	39.34±11.84	0.334
WBC (10⁹/L)		6.07±2.81	5.66±1.17	0.422
LYM (10⁹/L)		1.53±0.76	2.20±0.47	<0.001
NEU (10⁹/L)		4.12±2.09	3.12±0.93	0.043
RBC (10¹²/L)		4.12±0.67	4.89±0.32	<0.001
HGB (g/L)		113.48±14.73	135.67±17.63	<0.001
HCT (L/L)		0.37±0.38	0.42±0.43	<0.001
PLT (10⁹/L)		243.42±82.22	255.64±59.45	0.512
SLEDAI		6.74±3.35	-	-
WBC: White blood cell; LYM: Lymphocyte; NEU: Neutrophil; RBC: Red blood cell; HGB: Hemoglobin; HCT: Hematocrit; PLT: Platelet. Data are presented as Mean±SD. P values were calculated by Mann-Whitney U test or t test.

Fig.1 Agarose gel electrophoresis of fecal Streptococcus salivarius (SS) nucleic acids. A: Results of agarose gel electrophoresis. Lane 1: Deionized water (negative control); Lane 2: SS standard strain (positive control). a: Lanes 3-12 are SLE group, and lanes 13-24 are HC group; b: Lanes 3-10 are SLE group, and lanes 11-22 are HC group; c: Lanes 3-11 are SLE group, and lanes 12-17 are HC group; d: Lanes 3-10 are SLE group, and lanes 11-18 are HC group. B: Correlation analysis between the grayscale value of fecal SS nucleic acids from SLE patients and the SLEDAI score.

Fig.2 Distribution of peripheral blood immune cell subsets in SLE patients. A, B: NK cell proportions and absolute counts in SLE patients and HC groups. C, D: Total T cell absolute counts and subset proportions. E: CD8+ T cell subset proportions. F: CD4+ T cell absolute counts (n=35 in SLE group, n=38 in HC group). *P<0.05, ***P<0.001, ****P<0.0001.

Fig.3 Physical properties of Streptococcus salivarius-derived extracellular vesicles (SS-EVs)and their regulatory effect on NK cell receptors. A: Transmission electron microscopy (TEM) of SS-EVs (Scale bar=100 nm). B: NTA analysis showing size distribution of SS-EVs (100-200 nm). C: Western blotting of LTA protein expression in SS-EVs. D: qPCR analysis of mRNA expression changes of the activating receptors (TNF, GZMB, NKG2D, IL-2, and Perforin) and inhibitory receptors (NKG2A) in NK cells co-cultured with SS-EVs (n=3). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Fig.4 SS-EVs enhance cytotoxic effect of NK cells on target cells. A-D: Relationship between NK cell to target cell ratio (1:1 to 4:1) and NK cell cytotoxicity at a fixed SS-EV concentration (1 μg/mL) (n=3). E-H: Flow cytometry analysis of the effects of varying SS-EV concentrations (0.1-10 μg/mL) on NK cell cytotoxicity against 4 target cells (n=3). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Fig.5 SS-EVs gavage aggravates kidney pathological damage in MRL/lpr mice. A: Schematic diagram of animal grouping and gavage. B: Significant inflammatory cell infiltration in the kidneys of mice gavaged with SS-EVs. C: Significant perivascular inflammatory cell infiltration in the kidneys of mice gavaged with SS-EVs. D: SS-EVs damage the renal medulla and promote immune complex deposition. E:SS-EVs induce NK cell infiltration in the kidneys and renal apoptosis. F-I: ELISA for IL-6, TNF, IL-8, and CCL20 levels in mouse serum (n=6). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

References 38

[1]	Siegel CH, Sammaritano LR. Systemic lupus erythematosus: a review[J]. JAMA, 2024, 331(17): 1480-91. doi：10.1001/jama.2024.2315
[2]	Cojocaru M, Cojocaru IM, Silosi I, et al. Manifestations of systemic lupus erythematosus[J]. Maedica (Bucur), 2011, 6(4): 330-6.
[3]	Weckerle CE, Niewold TB. The unexplained female predominance of systemic lupus erythematosus: clues from genetic and cytokine studies[J]. Clin Rev Allergy Immunol, 2011, 40(1): 42-9. doi：10.1007/s12016-009-8192-4
[4]	McMurray RW, May W. Sex hormones and systemic lupus erythematosus: review and meta-analysis[J]. Arthritis Rheum, 2003, 48(8): 2100-10. doi：10.1002/art.11105
[5]	Rosario C, Seguro L, Vasconcelos C, et al. Is there a cure for systemic lupus erythematosus[J]? Lupus, 2013, 22(5): 417-21. doi：10.1177/0961203313479839
[6]	Yu HT, Nagafuchi Y, Fujio K. Clinical and immunological biomarkers for systemic lupus erythematosus[J]. Biomolecules, 2021, 11(7): 928. doi：10.3390/biom11070928
[7]	Suárez-Fueyo A, Bradley SJ, Tsokos GC. T cells in systemic lupus erythematosus[J]. Curr Opin Immunol, 2016, 43: 32-8. doi：10.1016/j.coi.2016.09.001
[8]	Karrar S, Cunninghame Graham DS. Abnormal B cell development in systemic lupus erythematosus: what the genetics tell us[J]. Arthritis Rheumatol, 2018, 70(4): 496-507. doi：10.1002/art.40396
[9]	Perera Arachchige AS. Human NK cells: From development to effector functions[J]. Innate Immun, 2021, 27(3): 212-29. doi：10.1177/17534259211001512
[10]	Mace EM. Human natural killer cells: Form, function, and development[J]. J Allergy Clin Immunol, 2023, 151(2): 371-85. doi：10.1016/j.jaci.2022.09.022
[11]	Jamal E, Azmy E, Ayed M, et al. Clinical impact of percentage of natural killer cells and natural killer-like T cell population in acute myeloid leukemia[J]. J Hematol, 2020, 9(3): 62-70. doi：10.14740/jh655
[12]	Ramírez-Labrada A, Pesini C, Santiago L, et al. All about (NK cell-mediated) death in two acts and an unexpected encore: initiation, execution and activation of adaptive immunity[J]. Front Immunol, 2022, 13: 896228. doi：10.3389/fimmu.2022.896228
[13]	Paul S, Lal G. The molecular mechanism of natural killer cells function and its importance in cancer immunotherapy[J]. Front Immunol, 2017, 8: 1124. doi：10.3389/fimmu.2017.01124
[14]	Wang W, Erbe AK, Hank JA, et al. NK cell-mediated antibody-dependent cellular cytotoxicity in cancer immunotherapy[J]. Front Immunol, 2015, 6: 368. doi：10.3389/fimmu.2015.00368
[15]	Hill GR, Betts BC, Tkachev V, et al. Current concepts and advances in graft-versus-host disease immunology[J]. Annu Rev Immunol, 2021, 39: 19-49. doi：10.1146/annurev-immunol-102119-073227
[16]	Xiao J, Luo YH, Duan LN, et al. Exploring differential gene expression and biomarker potential in systemic lupus erythematosus: a retrospective study[J]. PeerJ, 2025, 13: e19891. doi：10.7717/peerj.19891
[17]	Duarte-García A, Hocaoglu M, Valenzuela-Almada M, et al. Rising incidence and prevalence of systemic lupus erythematosus: a population-based study over four decades[J]. Ann Rheum Dis, 2022, 81(9): 1260-6. doi：10.1136/annrheumdis-2022-222276
[18]	Fu YF, Lyu J, Wang SS. The role of intestinal microbes on intestinal barrier function and host immunity from a metabolite perspective[J]. Front Immunol, 2023, 14: 1277102. doi：10.3389/fimmu.2023.1277102
[19]	Bechler KK, Stolyar L, Steinberg E, et al. Predicting patients who are likely to develop Lupus Nephritis of those newly diagnosed with Systemic Lupus Erythematosus[J]. AMIA Annu Symp Proc, 2023, 2022: 221-30.
[20]	Singh BK, Singh S. Systemic lupus erythematosus and infections[J]. Reumatismo, 2020, 72(3): 154-69. doi：10.4081/reumatismo.2020.1303
[21]	Jin LY, Xiao J, Luo YH, et al. Exploring gut microbiota in systemic lupus erythematosus: insights and biomarker discovery potential[J]. Clin Rev Allergy Immunol, 2025, 68(1): 42. doi：10.1007/s12016-025-09051-4
[22]	Yan R, Jiang HY, Gu SL, et al. Fecal metabolites were altered, identified as biomarkers and correlated with disease activity in patients with systemic lupus erythematosus in a GC-MS-based metabolomics study[J]. Front Immunol, 2020, 11: 2138. doi：10.3389/fimmu.2020.02138
[23]	Kaci G, Goudercourt D, Dennin V, et al. Anti-inflammatory properties of Streptococcus salivarius, a commensal bacterium of the oral cavity and digestive tract[J]. Appl Environ Microbiol, 2014, 80(3): 928-34. doi：10.1128/aem.03133-13
[24]	Wescombe PA, Hale JDF, Heng NCK, et al. Developing oral probiotics from Streptococcus salivarius [J]. Future Microbiol, 2012, 7(12): 1355-71. doi：10.2217/fmb.12.113
[25]	García-Ríos P, Pecci-Lloret MP, Oñate-Sánchez RE. Oral manifestations of systemic lupus erythematosus: a systematic review[J]. Int J Environ Res Public Health, 2022, 19(19): 11910. doi：10.3390/ijerph191911910
[26]	Duan LN, Lin WY, Zhang Y, et al. Exosomes in autoimmune diseases: a review of mechanisms and diagnostic applications[J]. Clin Rev Allergy Immunol, 2025, 68(1): 5. doi：10.1007/s12016-024-09013-2
[27]	Muñoz-Echeverri LM, Benavides-López S, Geiger O, et al. Bacterial extracellular vesicles: biotechnological perspective for enhanced productivity[J]. World J Microbiol Biotechnol, 2024, 40(6): 174. doi：10.1007/s11274-024-03963-7
[28]	Ou ZH, Bo ST, Huang XY, et al. Single-particle analysis of circulating bacterial extracellular vesicles reveals their biogenesis, changes in blood and links to intestinal barrier[J]. J Extracell Vesicles, 2023, 12(12): e12395. doi：10.1002/jev2.12395
[29]	Nie XK, Li QQ, Chen XY, et al. Bacterial extracellular vesicles: Vital contributors to physiology from bacteria to host[J]. Microbiol Res, 2024, 284: 127733. doi：10.1016/j.micres.2024.127733
[30]	Gao Y, Zhang YK, Liu XG. Rheumatoid arthritis: pathogenesis and therapeutic advances[J]. MedComm (2020), 2024, 5(3): e509. doi：10.1002/mco2.509
[31]	Mueller AL, Payandeh Z, Mohammadkhani N, et al. Recent advances in understanding the pathogenesis of rheumatoid arthritis: new treatment strategies[J]. Cells, 2021, 10(11): 3017. doi：10.3390/cells10113017
[32]	Hong MK, Li Z, Liu HH, et al. Fusobacterium nucleatum aggravates rheumatoid arthritis through FadA-containing outer membrane vesicles[J]. Cell Host Microbe, 2023, 31(5): 798-810.e7. doi：10.1016/j.chom.2023.03.018
[33]	Salgueiro VC, Passemar C, Vázquez-Iniesta L, et al. Extracellular vesicles in mycobacteria: new findings in biogenesis, host-pathogen interactions, and diagnostics[J]. mBio, 2024, 15(5): e0255223. doi：10.1128/mbio.02552-23
[34]	Kucuksezer UC, Aktas Cetin E, Esen F, et al. The role of natural killer cells in autoimmune diseases[J]. Front Immunol, 2021, 12: 622306. doi：10.3389/fimmu.2021.622306
[35]	Novelli L, Barbati C, Capuano C, et al. KLRG1 is reduced on NK cells in SLE patients, inversely correlates with disease activity and is modulated by hydroxychloroquine in vitro [J]. Lupus, 2023, 32(4): 549-59. doi：10.1177/09612033231160979
[36]	Seow WK, Lam JHC, Tsang AKL, et al. Oral Streptococcus species in pre-term and full-term children-a longitudinal study[J]. Int J Paediatr Dent, 2009, 19(6): 406-11. doi：10.1111/j.1365-263x.2009.01003.x
[37]	Iraci N, Leonardi T, Gessler F, et al. Focus on extracellular vesicles: physiological role and signalling properties of extracellular membrane vesicles[J]. Int J Mol Sci, 2016, 17(2): 171. doi：10.3390/ijms17020171
[38]	Rafieezadeh D, Rafieezadeh A. Extracellular vesicles and their therapeutic applications: a review article (part1)[J]. Int J Physiol Pathophysiol Pharmacol, 2024, 16(1): 1-9. doi：10.62347/qpag5693