column:Sanguinarine alleviates ulcerative colitis in mice by regulating the Nrf2/NF-κB pathway

doi:10.12122/j.issn.1673-4254.2024.08.05

Abstract

Abstract:

Objective To investigate the mechanism of sanguinarine (SA) for alleviating ulcerative colitis (UC) induced by dextran sodium sulfate (DSS) in mice. Methods Male C57BL/6 mouse models of 3.5% DSS-induced UC were randomized for treatment with 1, 5 and 10 mg/kg SA by gavage, 400 mg/kg sulfasalazine by gavage, or 10 mg/kg SA combined with intraperitoneal injection of 30 mg/kg ML385 (a Nrf2 inhibitor). The changes in intestinal inflammation was assessed by monitoring weight changes, disease activity index (DAI) score, colon length measurement, and HE staining. After the treatments, the colon tissues were collected for detection of malondialdehyde (MDA) content using colorimetry, mRNA expressions of inflammatory factors using RT-qPCR, and the expressions of Nrf2, HO-1, Keap-1, p-p65, p65, occludin, and ZO-1 proteins were detected using Western blotting. Results SA treatment obviously alleviated weight loss, colon length shortening and DAI score increase and ameliorated structural destruction of the colon glands and colonic crypts in mice with DSS-induced UC. SA intervention significantly decreased the levels of TNF-α, IL-1β and IL-6 mRNA and lowered ROS and MDA levels in the colon tissue of UC mice. The mouse models receiving SA treatment showed significantly increased expressions of Nrf2, HO-1, occludin and ZO-1 and lowered expressions of Keap-1 and P-P65 in the colon tissue without significant changes of p65 expression, and these changes were SA dose-dependent. Treatment with ML385 obviously attenuated the effect of high-dose SA for improving UC in the mouse models. Conclusion SA can improve UC-like enteritis in mice possibly by activating the Nrf2 pathway and inhibiting the NF-κB pathway in the colon tissue.

Key words: ulcerative colitis, sanguinarine, Nrf2, nuclear factor-κB

Na ZHAO, Mengdi SHEN, Rui ZHAO, Di AO, Zetan LUO, Yinliang ZHANG, Zhidong XU, Fangtian FAN, Hailun ZHENG. column:Sanguinarine alleviates ulcerative colitis in mice by regulating the Nrf2/NF-κB pathway[J]. Journal of Southern Medical University, 2024, 44(8): 1467-1475.

Figures/Tables 7

Tab.1 Primer sequence for RT-qPCR

Gene	Forward	Reverse
TNF-α	CGTCGTAGCAAACCACCAA	GGGCAGCCTTGTCCCTTGA
IL- 1β	CTCAACTGTGAAATGCCACC	GAGTGATACTGCCTGCCTGA
IL-6	ATGGCAATTCTGATTGTATG	GACTCTGGCTTTGTCTTTCT
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA

Fig.1 Protective effect of SA against DSS-induced UC in mice. A: Changes of body weight. B: Changes of DAI scores. C, D: Comparison of colon length among the groups. *P<0.05 vs DSS group. #P<0.05 vs control.

Fig.2 HE staining of mouse colon tissues in different groups.

Fig.3 Effect of SA intervention on intestinal barrier function in DSS-induced UC mice. A: Western blotting results. B, C:Comparison of protein expression levels among the groups. *P<0.05 vs DSS group. #P<0.05 vs control.

Fig.4 Effect of SA intervention on intestinal inflammation and oxidative stress in UC mice. A-C: Changes in intestinal inflammatory factors in different groups. D-F: Changes in intestinal oxidative stress in different groups. *P<0.05 vs DSS group, #P<0.05 vs control.

Fig.5 Expression levels of NF-κBp65, p-p65, Keap-1, Nrf2 and HO-1 in intestinal tissues of mice in each group. A: Western blotting results. B-F: Changes in the protein expression levels.*P<0.05 vs DSS group. #P<0.05 vs control.

Fig.7 Effect of ML385 on inflammatory factors, ROS, and MDA in UC mice. A-C: Changes in inflammatory factors in colonic tissues. D-F: Changes in indicators of oxidative stress in the colon tissue. *P<0.05 vs DSS group. #P<0.05 vs control. $P<0.05 vs DSS+SA-H.

References 36

1	Le Berre C, Honap S, Peyrin-Biroulet L. Ulcerative colitis[J]. Lancet, 2023, 402(10401): 571-84.
2	Gajendran M, Loganathan P, Jimenez G, et al. A comprehensive review and update on ulcerative colitis[J]. Dis Mon, 2019, 65(12): 100851-9.
3	Peng S, Shen L, Yu XY, et al. The role of Nrf2 in the pathogenesis and treatment of ulcerative colitis[J]. Front Immunol, 2023, 14: 1200111-23.
4	Qiu SJ, Li P, Zhao HF, et al. Maresin 1 alleviates dextran sulfate sodium-induced ulcerative colitis by regulating NRF2 and TLR4/NF-kB signaling pathway[J]. Int Immunopharmacol, 2020, 78: 106018.
5	Yuan ZW, Yang LH, Zhang XS, et al. Huang-Lian-Jie-du decoction ameliorates acute ulcerative colitis in mice via regulating NF-κB and Nrf2 signaling pathways and enhancing intestinal barrier function[J]. Front Pharmacol, 2019, 10: 1354.
6	Wardyn JD, Ponsford AH, Sanderson CM. Dissecting molecular cross-talk between Nrf2 and NF‑κB response pathways[J]. Biochem Soc Trans, 2015, 43(4): 621-6.
7	Lee JS, Jung WK, Jeong MH, et al. Sanguinarine induces apoptosis of HT-29 human colon cancer cells via the regulation of Bax/Bcl-2 ratio and caspase-9-dependent pathway[J]. Int J Toxicol, 2012, 31(1): 70-7.
8	Mitscher LA, Drake S, Gollapudi SR, et al. A modern look at folkloric use of anti-infective agents[J]. J Nat Prod, 1987, 50(6): 1025-40.
9	Lin XL, Shi YN, Cao YL, et al. Sanguinarine protects against indomethacin-induced small intestine injury in rats by regulating the Nrf2/NF-κB pathways[J]. Front Pharmacol, 2022, 13: 960140.
10	Zheng ZJ, Zheng YH, Liang XB, et al. Sanguinarine enhances the integrity of the blood-milk barrier and inhibits oxidative stress in lipopolysaccharide-stimulated mastitis[J]. Cells, 2022, 11(22): 3658.
11	Li XD, Wu X, Wang Q, et al. Sanguinarine ameliorates DSS induced ulcerative colitis by inhibiting NLRP3 inflammasome activation and modulating intestinal microbiota in C57BL/6 mice[J]. Phytomedicine, 2022, 106: 154394.
12	Becci PJ, Schwartz H, Barnes HH, et al. Short-term toxicity studies of sanguinarine and of two alkaloid extracts of Sanguinaria canadensis L[J]. J Toxicol Environ Health, 1987, 20(1/2): 199-208.
13	Niu XF, Fan T, Li WF, et al. Protective effect of sanguinarine against acetic acid-induced ulcerative colitis in mice[J]. Toxicol Appl Pharmacol, 2013, 267(3): 256-65.
14	Chaudhary G, Mahajan UB, Goyal SN, et al. Protective effect of Lagerstroemia speciosa against dextran sulfate sodium induced ulcerative colitis in C57BL/6 mice[J]. Am J Transl Res, 2017, 9(4): 1792-800.
15	Li BT, Wang YX, Jiang XL, et al. Natural products targeting Nrf2/ARE signaling pathway in the treatment of inflammatory bowel disease[J]. Biomedecine Pharmacother, 2023, 164: 114950.
16	Gupta M, Mishra V, Gulati M, et al. Natural compounds as safe therapeutic options for ulcerative colitis[J]. Inflammopharm-acology, 2022, 30(2): 397-434.
17	Gros B, Kaplan GG. Ulcerative colitis in adults: a review[J]. JAMA, 2023, 330(10): 951-65.
18	Liu Y, Li BG, Su YH, et al. Potential activity of Traditional Chinese Medicine against Ulcerative colitis: a review[J]. J Ethnopharmacol, 2022, 289: 115084.
19	Li CL, Wang JH, Ma RF, et al. Natural-derived alkaloids exhibit great potential in the treatment of ulcerative colitis[J]. Pharmacol Res, 2022, 175: 105972.
20	Wu J, Yang CL, Sha YK, et al. Koumine alleviates lipopolysaccharide-induced intestinal barrier dysfunction in IPEC-J2 cells by regulating Nrf2/NF‑κB pathway[J]. Am J Chin Med, 2020, 48(1): 127-42.
21	Zhang HH, Lang WY, Liu X, et al. Procyanidin A1 alleviates DSS-induced ulcerative colitis via regulating AMPK/mTOR/p70S6K-mediated autophagy[J]. J Physiol Biochem, 2022, 78(1): 213-27.
22	Zielińska S, Czerwińska ME, Dziągwa-Becker M, et al. Modulatory effect of Chelidonium majus extract and its alkaloids on LPS-stimulated cytokine secretion in human neutrophils[J]. Molecules, 2020, 25(4): 842.
23	Huang LJ, Lan JX, Wang JH, et al. Bioactivity and mechanism of action of sanguinarine and its derivatives in the past 10 years[J]. Biomedecine Pharmacother, 2024, 173: 116406.
24	Meng YY, Liu Y, Hu ZF, et al. Sanguinarine attenuates lipopolysaccharide-induced inflammation and apoptosis by inhibiting the TLR4/NF‑κB pathway in H9c2 cardiomyocytes[J]. Curr Med Sci, 2018, 38(2): 204-11.
25	Jena G, Trivedi PP, Sandala B. Oxidative stress in ulcerative colitis: an old concept but a new concern[J]. Free Radic Res, 2012, 46(11): 1339-45.
26	Wang J, Zhang CL, Guo CM, et al. Chitosan ameliorates DSS-induced ulcerative colitis mice by enhancing intestinal barrier function and improving microflora[J]. Int J Mol Sci, 2019, 20(22): 5751.
27	Liu DY, Huo XW, Gao L, et al. NF-κB and Nrf2 pathways contribute to the protective effect of Licochalcone A on dextran sulphate sodium-induced ulcerative colitis in mice[J]. Biomedecine Pharmacother, 2018, 102: 922-9.
28	Tao MH, Yan W, Chen CY, et al. Omentin-1 ameliorates experimental inflammatory bowel disease via Nrf2 activation and redox regulation[J]. Life Sci, 2023, 328: 121847.
29	Chen YE, Xu SJ, Lu YY, et al. Asperuloside suppressing oxidative stress and inflammation in DSS-induced chronic colitis and RAW 264.7 macrophages via Nrf2/HO-1 and NF-κB pathways[J]. Chem Biol Interact, 2021, 344: 109512.
30	He F, Antonucci L, Karin M. NRF2 as a regulator of cell metabolism and inflammation in cancer[J]. Carcinogenesis, 2020, 41(4): 405-16.
31	Lin C, Zhou ZH, Zhang LJ, et al. Gegen Qinlian Decoction relieves ulcerative colitis via adjusting dysregulated Nrf2/ARE signaling[J]. Evid Based Complement Alternat Med, 2022, 2022: 2934552.
32	Poma PL. NF-κB and disease[J]. Int J Mol Sci, 2020, 21(23): 9181.
33	Laurindo LF, Santos AROD, Carvalho ACA, et al. Phytochemicals and regulation of NF-kB in inflammatory bowel diseases: an overview of in vitro and in vivo effects[J]. Metabolites, 2023, 13(1): 96.
34	Chen Y, Miao ZW, Sheng XJ, et al. Sesquiterpene lactones-rich fraction from Aucklandia lappa Decne. alleviates dextran sulfate sodium induced ulcerative colitis through co-regulating MAPK and Nrf2/Hmox-1 signaling pathway[J]. J Ethnopharmacol, 2022, 295: 115401.
35	Sahin K, Pala R, Tuzcu M, et al. Curcumin prevents muscle damage by regulating NF-κB and Nrf2 pathways and improves performance: an in vivo model[J]. J Inflamm Res, 2016, 9: 147-54.
36	Sun YY, Zhu HJ, Zhao RY, et al. Remote ischemic conditioning attenuates oxidative stress and inflammation via the Nrf2/HO-1 pathway in MCAO mice[J]. Redox Biol, 2023, 66: 102852.

[1]	Fangyuan ZHANG, Gang LIU. Dexmedetomidine inhibits ferroptosis of human renal tubular epithelial cells by activating the Nrf2/HO-1/GPX4 pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1135-1140.
[2]	WANG Qiong, XU Fengqing, DENG Mengyun, REN Mengting, WANG Tongsheng, WU Deling. Antioxidant activity of Euryale ferox seed shell extract and its therapeutic effects on oral ulcer in rats [J]. Journal of Southern Medical University, 2024, 44(4): 787-794.
[3]	REN Li, ZOU Mingyuan, ZHU Xingchun, XU Wenjun, LIU Gang, SUN Junjie, FAN Fangtian, ZHANG Congli. Curcumin suppresses proliferation, migration and invasion of papillary thyriod cancer B-CPAP cells through the Keap1-Nrf2 pathway [J]. Journal of Southern Medical University, 2023, 43(8): 1356-1362.
[4]	WANG Liya, TIAN Meihui, LI Rong, WU Yue, WANG Shasha, LÜ Heng, LIU Zhongyi, YU Ying. Acetaldehyde dehydrogenase 2 ameliorates lung endothelial barrier and balances mitochondrial dynamics in mice with acute lung injury [J]. Journal of Southern Medical University, 2023, 43(8): 1388-1395.
[5]	SONG Zejun, DONG Haibin, MA Na, REN Yutang, JIANG Bo. Value of Improved Mayo Endoscopic Score for evaluating treatment efficacy for active ulcerative colitis [J]. Journal of Southern Medical University, 2023, 43(7): 1204-1213.
[6]	LIU Lilan, DENG Ruya, ZHOU Wenjin, LIN Min, XIA Lingzi, GAO Haitao. Mechanisms mediating the inhibitory effects of quercetin against phthalates-induced testicular oxidative damage in rats [J]. Journal of Southern Medical University, 2023, 43(4): 577-584.
[7]	LIU Min, JIN Hua, HU Qin, CHEN Nuo, ZHANG Yeqing, WANG Yiping. Qingshen Granules-medicated serum reduces transdifferentiation of NRK-52E cells by miR-23b-5p-mediated activation of the Nrf2 pathway [J]. Journal of Southern Medical University, 2023, 43(12): 2078-2085.
[8]	CAO Jing, LIU Haibo, AN Qi, HAN Feng. Metformin alleviates pathologic pain in mice with radiation dermatitis by inhibiting p38MAPK/NF-κB signaling pathway [J]. Journal of Southern Medical University, 2023, 43(10): 1815-1820.
[9]	LI Wei, SHI Yongkang, GUO Yuhua, TIAN Shengwang. Nur77 promotes invasion and migration of gastric cancer cells through the NF-κB/IL-6 pathway [J]. Journal of Southern Medical University, 2022, 42(9): 1410-1417.
[10]	WANG Shaoxin, CUI Lihong, LIU Xinyao, LUO Zhe, LI Hui, PU Jiang. WDSUB1 knockdown alleviates dextran sulfate sodium-induced colitis in mice by inhibiting nuclear factor-κB signaling pathway [J]. Journal of Southern Medical University, 2022, 42(8): 1119-1125.
[11]	KUERBANNAIMU Kaheman, ZHAO Jianfeng, MUKAIDAISI Aihemaiti, WANG Hanming, ZHU Jiwei, PAN Wentao, KASIMUJIANG Aximujiang. E.faecium QH06 alleviates TNBS-induced colonic mucosal injury in rats [J]. Journal of Southern Medical University, 2022, 42(7): 976-987.
[12]	SONG Zejun, ZHANG Mingjun, REN Yutang, JIANG Bo. Improved Mayo Endoscopic Score has a higher value for evaluating clinical severity of ulcerative colitis [J]. Journal of Southern Medical University, 2022, 42(7): 997-1005.
[13]	CAO Chunhao, ZENG Li, RONG Xiaofeng. Therapeutic mechanism of emodin for treatment of rheumatoid arthritis: a network pharmacology-based analysis [J]. Journal of Southern Medical University, 2022, 42(6): 913-921.
[14]	HUANG Qingyang, JI Dongdong, TIAN Xiuyun, MA Linyan, SUN Xiaojin. Berberine inhibits erastin-induced ferroptosis of mouse hippocampal neuronal cells possibly by activating the Nrf2-HO-1/GPX4 pathway [J]. Journal of Southern Medical University, 2022, 42(6): 937-943.
[15]	LIU Siyu, LIU Qing, PENG Qunlong, ZHANG Yuanfang, WANG Junjie. Dihydromyricetin improves cardiac insufficiency by inhibiting HMGB1 in diabetic rats [J]. Journal of Southern Medical University, 2022, 42(5): 641-648.