Journal of Southern Medical University ›› 2024, Vol. 44 ›› Issue (8): 1467-1475.doi: 10.12122/j.issn.1673-4254.2024.08.05
Previous Articles Next Articles
Na ZHAO1(
), Mengdi SHEN1, Rui ZHAO1, Di AO1, Zetan LUO1, Yinliang ZHANG1, Zhidong XU1, Fangtian FAN2,3, Hailun ZHENG1(
)
Received:2024-04-14
Online:2024-08-20
Published:2024-09-06
Contact:
Hailun ZHENG
E-mail:461296895@qq.com;alanhailun@163.com
Na ZHAO, Mengdi SHEN, Rui ZHAO, Di AO, Zetan LUO, Yinliang ZHANG, Zhidong XU, Fangtian FAN, Hailun ZHENG. column:Sanguinarine alleviates ulcerative colitis in mice by regulating the Nrf2/NF-κB pathway[J]. Journal of Southern Medical University, 2024, 44(8): 1467-1475.
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.j-smu.com/EN/10.12122/j.issn.1673-4254.2024.08.05
| Gene | Forward | Reverse |
|---|---|---|
| TNF-α | CGTCGTAGCAAACCACCAA | GGGCAGCCTTGTCCCTTGA |
| IL- 1β | CTCAACTGTGAAATGCCACC | GAGTGATACTGCCTGCCTGA |
| IL-6 | ATGGCAATTCTGATTGTATG | GACTCTGGCTTTGTCTTTCT |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Tab.1 Primer sequence for RT-qPCR
| Gene | Forward | Reverse |
|---|---|---|
| TNF-α | CGTCGTAGCAAACCACCAA | GGGCAGCCTTGTCCCTTGA |
| IL- 1β | CTCAACTGTGAAATGCCACC | GAGTGATACTGCCTGCCTGA |
| IL-6 | ATGGCAATTCTGATTGTATG | GACTCTGGCTTTGTCTTTCT |
| GAPDH | AGGTCGGTGTGAACGGATTTG | TGTAGACCATGTAGTTGAGGTCA |
Fig.1 Protective effect of SA against DSS-induced UC in mice. A: Changes of body weight. B: Changes of DAI scores. C, D: Comparison of colon length among the groups. *P<0.05 vs DSS group. #P<0.05 vs control.
Fig.3 Effect of SA intervention on intestinal barrier function in DSS-induced UC mice. A: Western blotting results. B, C:Comparison of protein expression levels among the groups. *P<0.05 vs DSS group. #P<0.05 vs control.
Fig.4 Effect of SA intervention on intestinal inflammation and oxidative stress in UC mice. A-C: Changes in intestinal inflammatory factors in different groups. D-F: Changes in intestinal oxidative stress in different groups. *P<0.05 vs DSS group, #P<0.05 vs control.
Fig.5 Expression levels of NF-κBp65, p-p65, Keap-1, Nrf2 and HO-1 in intestinal tissues of mice in each group. A: Western blotting results. B-F: Changes in the protein expression levels.*P<0.05 vs DSS group. #P<0.05 vs control.
Fig.7 Effect of ML385 on inflammatory factors, ROS, and MDA in UC mice. A-C: Changes in inflammatory factors in colonic tissues. D-F: Changes in indicators of oxidative stress in the colon tissue. *P<0.05 vs DSS group. #P<0.05 vs control. $P<0.05 vs DSS+SA-H.
| 1 | Le Berre C, Honap S, Peyrin-Biroulet L. Ulcerative colitis[J]. Lancet, 2023, 402(10401): 571-84. |
| 2 | Gajendran M, Loganathan P, Jimenez G, et al. A comprehensive review and update on ulcerative colitis[J]. Dis Mon, 2019, 65(12): 100851-9. |
| 3 | Peng S, Shen L, Yu XY, et al. The role of Nrf2 in the pathogenesis and treatment of ulcerative colitis[J]. Front Immunol, 2023, 14: 1200111-23. |
| 4 | Qiu SJ, Li P, Zhao HF, et al. Maresin 1 alleviates dextran sulfate sodium-induced ulcerative colitis by regulating NRF2 and TLR4/NF-kB signaling pathway[J]. Int Immunopharmacol, 2020, 78: 106018. |
| 5 | Yuan ZW, Yang LH, Zhang XS, et al. Huang-Lian-Jie-du decoction ameliorates acute ulcerative colitis in mice via regulating NF-κB and Nrf2 signaling pathways and enhancing intestinal barrier function[J]. Front Pharmacol, 2019, 10: 1354. |
| 6 | Wardyn JD, Ponsford AH, Sanderson CM. Dissecting molecular cross-talk between Nrf2 and NF‑κB response pathways[J]. Biochem Soc Trans, 2015, 43(4): 621-6. |
| 7 | Lee JS, Jung WK, Jeong MH, et al. Sanguinarine induces apoptosis of HT-29 human colon cancer cells via the regulation of Bax/Bcl-2 ratio and caspase-9-dependent pathway[J]. Int J Toxicol, 2012, 31(1): 70-7. |
| 8 | Mitscher LA, Drake S, Gollapudi SR, et al. A modern look at folkloric use of anti-infective agents[J]. J Nat Prod, 1987, 50(6): 1025-40. |
| 9 | Lin XL, Shi YN, Cao YL, et al. Sanguinarine protects against indomethacin-induced small intestine injury in rats by regulating the Nrf2/NF-κB pathways[J]. Front Pharmacol, 2022, 13: 960140. |
| 10 | Zheng ZJ, Zheng YH, Liang XB, et al. Sanguinarine enhances the integrity of the blood-milk barrier and inhibits oxidative stress in lipopolysaccharide-stimulated mastitis[J]. Cells, 2022, 11(22): 3658. |
| 11 | Li XD, Wu X, Wang Q, et al. Sanguinarine ameliorates DSS induced ulcerative colitis by inhibiting NLRP3 inflammasome activation and modulating intestinal microbiota in C57BL/6 mice[J]. Phytomedicine, 2022, 106: 154394. |
| 12 | Becci PJ, Schwartz H, Barnes HH, et al. Short-term toxicity studies of sanguinarine and of two alkaloid extracts of Sanguinaria canadensis L[J]. J Toxicol Environ Health, 1987, 20(1/2): 199-208. |
| 13 | Niu XF, Fan T, Li WF, et al. Protective effect of sanguinarine against acetic acid-induced ulcerative colitis in mice[J]. Toxicol Appl Pharmacol, 2013, 267(3): 256-65. |
| 14 | Chaudhary G, Mahajan UB, Goyal SN, et al. Protective effect of Lagerstroemia speciosa against dextran sulfate sodium induced ulcerative colitis in C57BL/6 mice[J]. Am J Transl Res, 2017, 9(4): 1792-800. |
| 15 | Li BT, Wang YX, Jiang XL, et al. Natural products targeting Nrf2/ARE signaling pathway in the treatment of inflammatory bowel disease[J]. Biomedecine Pharmacother, 2023, 164: 114950. |
| 16 | Gupta M, Mishra V, Gulati M, et al. Natural compounds as safe therapeutic options for ulcerative colitis[J]. Inflammopharm-acology, 2022, 30(2): 397-434. |
| 17 | Gros B, Kaplan GG. Ulcerative colitis in adults: a review[J]. JAMA, 2023, 330(10): 951-65. |
| 18 | Liu Y, Li BG, Su YH, et al. Potential activity of Traditional Chinese Medicine against Ulcerative colitis: a review[J]. J Ethnopharmacol, 2022, 289: 115084. |
| 19 | Li CL, Wang JH, Ma RF, et al. Natural-derived alkaloids exhibit great potential in the treatment of ulcerative colitis[J]. Pharmacol Res, 2022, 175: 105972. |
| 20 | Wu J, Yang CL, Sha YK, et al. Koumine alleviates lipopolysaccharide-induced intestinal barrier dysfunction in IPEC-J2 cells by regulating Nrf2/NF‑κB pathway[J]. Am J Chin Med, 2020, 48(1): 127-42. |
| 21 | Zhang HH, Lang WY, Liu X, et al. Procyanidin A1 alleviates DSS-induced ulcerative colitis via regulating AMPK/mTOR/p70S6K-mediated autophagy[J]. J Physiol Biochem, 2022, 78(1): 213-27. |
| 22 | Zielińska S, Czerwińska ME, Dziągwa-Becker M, et al. Modulatory effect of Chelidonium majus extract and its alkaloids on LPS-stimulated cytokine secretion in human neutrophils[J]. Molecules, 2020, 25(4): 842. |
| 23 | Huang LJ, Lan JX, Wang JH, et al. Bioactivity and mechanism of action of sanguinarine and its derivatives in the past 10 years[J]. Biomedecine Pharmacother, 2024, 173: 116406. |
| 24 | Meng YY, Liu Y, Hu ZF, et al. Sanguinarine attenuates lipopolysaccharide-induced inflammation and apoptosis by inhibiting the TLR4/NF‑κB pathway in H9c2 cardiomyocytes[J]. Curr Med Sci, 2018, 38(2): 204-11. |
| 25 | Jena G, Trivedi PP, Sandala B. Oxidative stress in ulcerative colitis: an old concept but a new concern[J]. Free Radic Res, 2012, 46(11): 1339-45. |
| 26 | Wang J, Zhang CL, Guo CM, et al. Chitosan ameliorates DSS-induced ulcerative colitis mice by enhancing intestinal barrier function and improving microflora[J]. Int J Mol Sci, 2019, 20(22): 5751. |
| 27 | Liu DY, Huo XW, Gao L, et al. NF-κB and Nrf2 pathways contribute to the protective effect of Licochalcone A on dextran sulphate sodium-induced ulcerative colitis in mice[J]. Biomedecine Pharmacother, 2018, 102: 922-9. |
| 28 | Tao MH, Yan W, Chen CY, et al. Omentin-1 ameliorates experimental inflammatory bowel disease via Nrf2 activation and redox regulation[J]. Life Sci, 2023, 328: 121847. |
| 29 | Chen YE, Xu SJ, Lu YY, et al. Asperuloside suppressing oxidative stress and inflammation in DSS-induced chronic colitis and RAW 264.7 macrophages via Nrf2/HO-1 and NF-κB pathways[J]. Chem Biol Interact, 2021, 344: 109512. |
| 30 | He F, Antonucci L, Karin M. NRF2 as a regulator of cell metabolism and inflammation in cancer[J]. Carcinogenesis, 2020, 41(4): 405-16. |
| 31 | Lin C, Zhou ZH, Zhang LJ, et al. Gegen Qinlian Decoction relieves ulcerative colitis via adjusting dysregulated Nrf2/ARE signaling[J]. Evid Based Complement Alternat Med, 2022, 2022: 2934552. |
| 32 | Poma PL. NF-κB and disease[J]. Int J Mol Sci, 2020, 21(23): 9181. |
| 33 | Laurindo LF, Santos AROD, Carvalho ACA, et al. Phytochemicals and regulation of NF-kB in inflammatory bowel diseases: an overview of in vitro and in vivo effects[J]. Metabolites, 2023, 13(1): 96. |
| 34 | Chen Y, Miao ZW, Sheng XJ, et al. Sesquiterpene lactones-rich fraction from Aucklandia lappa Decne. alleviates dextran sulfate sodium induced ulcerative colitis through co-regulating MAPK and Nrf2/Hmox-1 signaling pathway[J]. J Ethnopharmacol, 2022, 295: 115401. |
| 35 | Sahin K, Pala R, Tuzcu M, et al. Curcumin prevents muscle damage by regulating NF-κB and Nrf2 pathways and improves performance: an in vivo model[J]. J Inflamm Res, 2016, 9: 147-54. |
| 36 | Sun YY, Zhu HJ, Zhao RY, et al. Remote ischemic conditioning attenuates oxidative stress and inflammation via the Nrf2/HO-1 pathway in MCAO mice[J]. Redox Biol, 2023, 66: 102852. |
| [1] | Bing XIA, Jin PENG, Jiuyang DING, Jie WANG, Guowei TANG, Guojie LIU, Yun WANG, Changwu WAN, Cuiyun LE. ATF3 regulates inflammatory response in atherosclerotic plaques in mice through the NF-κB signaling pathway [J]. Journal of Southern Medical University, 2025, 45(6): 1131-1142. |
| [2] | Lihua ZHOU, Xun ZHANG, Yingying YU, Panpan ZHANG. Role of the Nrf2/HO-1 pathway in cypermethrin-induced oxidative injury of mice hippocampal neurons [J]. Journal of Southern Medical University, 2025, 45(5): 893-900. |
| [3] | Lin SHEN, Cuihao SONG, Congmin WANG, Xi GAO, Junhong AN, Chengxin LI, Bin LIANG, Xia LI. Risk factors for malnutrition in ulcerative colitis complicated with pyoderma gangrenosum and construction of a lasso regression-based prediction model [J]. Journal of Southern Medical University, 2025, 45(3): 514-521. |
| [4] | Yang LIU, Yiqing JIA, Chengcheng LI, Handing MAO, Shuyuan LIU, Yi SHAN. Dexmedetomidine attenuates heat stress-induced oncosis in human skeletal muscle cells by activating the Nrf2/Ho-1 pathway [J]. Journal of Southern Medical University, 2025, 45(3): 603-613. |
| [5] | Na ZHONG, Huijie WANG, Wenying ZHAO, Zhengui SUN, Biao GENG. High RNF7 expression enhances PD-1 resistance of non-small cell lung cancer cells by promoting CXCL1 expression and myeloid-derived suppressor cell recruitment via activating NF-κB signaling [J]. Journal of Southern Medical University, 2024, 44(9): 1704-1711. |
| [6] | Guanzheng YU, Weiqiang CHENG, Xing TU, Man ZHANG, Hong LI, Juan NIE. Therapeutic mechanism of Cynanchum wilfordii for ulcerative colitis: an analysis using UPLC-QE-MS, network pharmacology and metabolomics [J]. Journal of Southern Medical University, 2024, 44(8): 1485-1496. |
| [7] | Yinliang ZHANG, Zetan LUO, Rui ZHAO, Na ZHAO, Zhidong XU, Di AO, Guyi CONG, Xinyu LIU, Hailun ZHENG. Sanguinarine induces ferroptosis of colorectal cancer cells by upregulating STUB1 and downregulating GPX4 [J]. Journal of Southern Medical University, 2024, 44(8): 1537-1544. |
| [8] | Fangyuan ZHANG, Gang LIU. Dexmedetomidine inhibits ferroptosis of human renal tubular epithelial cells by activating the Nrf2/HO-1/GPX4 pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1135-1140. |
| [9] | WANG Qiong, XU Fengqing, DENG Mengyun, REN Mengting, WANG Tongsheng, WU Deling. Antioxidant activity of Euryale ferox seed shell extract and its therapeutic effects on oral ulcer in rats [J]. Journal of Southern Medical University, 2024, 44(4): 787-794. |
| [10] | Jianguo QIU, Yitong QIU, Guorong LI, Linsheng ZHANG, Xue ZHENG, Yongjiang YAO, Xidan WANG, Haiyang HUANG, Fengmin ZHANG, Jiyan SU, Xuebao ZHENG, Xiaoqi HUANG. Huangqin Decoction alleviates ulcerative colitis in mice by reducing endoplasmic reticulum stress [J]. Journal of Southern Medical University, 2024, 44(11): 2172-2183. |
| [11] | Huajun CAI, Zhiqi CHEN, Wenting HU, Wei TAN, Hao WU, Chao WANG. Total flavonoids of Salvia miltiorrhiza alleviate acetaminophen-induced acute liver injury in mice by suppressing hepatocyte ferroptosis via activating the Nrf2/HO-1 signaling pathway [J]. Journal of Southern Medical University, 2024, 44(11): 2201-2208. |
| [12] | Qinjun YANG, Hui WANG, Shuyu XU, Cheng YANG, Huanzhang DING, Di WU, Jie ZHU, Jiabing TONG, Zegeng LI. Shenqi Tiaoshen Formula alleviates airway inflammation in rats with chronic obstructive pulmonary disease and kidney qi deficiency syndrome by inhibiting ferroptosis via regulating the Nrf2/SLC7A11/GPX4 signaling pathway [J]. Journal of Southern Medical University, 2024, 44(10): 1937-1946. |
| [13] | REN Li, ZOU Mingyuan, ZHU Xingchun, XU Wenjun, LIU Gang, SUN Junjie, FAN Fangtian, ZHANG Congli. Curcumin suppresses proliferation, migration and invasion of papillary thyriod cancer B-CPAP cells through the Keap1-Nrf2 pathway [J]. Journal of Southern Medical University, 2023, 43(8): 1356-1362. |
| [14] | WANG Liya, TIAN Meihui, LI Rong, WU Yue, WANG Shasha, LÜ Heng, LIU Zhongyi, YU Ying. Acetaldehyde dehydrogenase 2 ameliorates lung endothelial barrier and balances mitochondrial dynamics in mice with acute lung injury [J]. Journal of Southern Medical University, 2023, 43(8): 1388-1395. |
| [15] | SONG Zejun, DONG Haibin, MA Na, REN Yutang, JIANG Bo. Value of Improved Mayo Endoscopic Score for evaluating treatment efficacy for active ulcerative colitis [J]. Journal of Southern Medical University, 2023, 43(7): 1204-1213. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||