Human umbilical cord mesenchymal stem cell grafting alleviates inflammatory response in type 1 diabetic mice by suppressing M1 macrophage polarization through Chi3l1

doi:10.12122/j.issn.1673-4254.2025.12.21

Abstract

Abstract:

Objective To explore the role of Chi3l1 in human umbilical cord mesenchymal stem cell (hUC-MSCs) therapy of type 1 diabetes. Methods hUC-MSCs with stable Chi3l1 knockdown (sh-Chi3l1-MSCs) were constructed using a lentiviral vector and characterized by flow cytometry and adipogenic and osteogenic induction. In adult C57BL/6J mouse models of streptozotocin-induced T1DM, the therapeutic effects of sh-NC-MSCs and sh-Chi3l1-MSCs grafting were evaluated by observing changes in clinical manifestations, blood glucose, body weight and pancreatic tissue pathologies. Insulin content and macrophage infiltration in the islets were detected using immunohistochemistry and immunofluorescence staining. The effects of these two stem cells on induced polarization of co-cultured mouse bone marrow macrophages were assessed using flow cytometry by detecting the mRNA expressions of iNOS, Arg-1, TNF-α, IL-6, IL-10, IL-13, and IL-1β using qPCR. Results The constructed sh-Chi3l1-MSCs retained the characteristics of MSCs but showed reduced therapeutic efficacy in T1DM mice. Immunofluorescence staining showed that the number of macrophages in the pancreatic tissue of the mice treated with sh-Chi3l1-MSCs was higher than that in MSCs treatment group. In the co-culture experiments, sh-Chi3l1-MSCs exhibited a lowered capacity to suppress M1 polarization of the macrophages and a reduced efficacy to promote differentiation of M2-type macrophage subset. Analysis with qPCR showed that the expressions of M1 macrophage marker iNOS and the inflammatory factors TNF-α, IL-6, and IL-1β increased, while the expressions of M2 macrophage marker Arg-1 and the cytokines IL-13 and IL-10 were decreased significantly in sh-Chi3l1-MSCs group. Conclusion In T1DM mouse models, hUC-MSCs mitigate inflammatory responses by suppressing the production of pro-inflammatory M1-type macrophages via Chi3l1.

Key words: human umbilical cord mesenchymal stem cells, Chi3l1, M1-type macrophage polarization, type 1 diabetes mellitus

Xinxin LIU, Yingrui XU, Hongna SHENG, Hao LIU. Human umbilical cord mesenchymal stem cell grafting alleviates inflammatory response in type 1 diabetic mice by suppressing M1 macrophage polarization through Chi3l1[J]. Journal of Southern Medical University, 2025, 45(12): 2738-2746.

Figures/Tables 5

Tab.1 Primer sequences for qPCR

Primer	Sequence (5'→3')
GAPDH	Forword:	ACACTCCAGCTGGGGCTGTACTGACTTGATG
	Reverse:	CTCAACTGGTGTCGTGGAGTCG GCAATTCAGTTGAGCATCAGAT
Chi3l1	Forword:	AAGCAACGATCACATCGACAC
	Reverse:	TCAGGTTGGGGTTCCTGTTCT
iNOS	Forword:	CCAACAATACAAGATGACCCT
	Reverse:	TTCTGGAACATTCTGTGCTG
Arg-1	Forword:	GAACTGAAAGGAAAGTTCCCA
	Reverse:	AATGTACACGATGTCTTTGGC
TNF-α	Forword:	GGCAGGTCTACTTTFFAGTCATTGC
	Reverse:	ACATTCGAGGCTCCAGTGAATTCGG
IL-6	Forword:	TACCACTTCACAAGTCGGA
	Reverse:	AATTGCCATTGCACAACTC
IL-10	Forword:	TTAATAAGCTCCAAGACCAAGG
	Reverse:	CATCATGTATGCTTCTATGCAG
IL-13	Forword:	TCCCTCAAGTTCTTTGTTCG
	Reverse:	CGCACCTTTCTGGTTACAC
IL-1β	Forword:	CCTCAAAGGAAAGAATCTATACCTG
	Reverse:	CTTGGGATCCACACTCTCC

Fig.1 Identification of MSCs with stable Chi3l1 knockdown. A: Morphology of sh-NC-MSCs. B: Oil Red O staining of sh-NC-MSCs after adipogenic induction. C: Alizarin Red S staining of sh-NC-MSCs after osteogenic induction. D: Morphology of sh-Chi3l1-MSCs. E: Oil Red O staining of sh-Chi3l1-MSCs after adipogenic induction. F: Alizarin Red S staining of sh-Chi3l1-MSCs after osteogenic induction. G: Detection of surface markers on sh-Chi3l1-MSCs by flow cytometry. H: Chi3l1 mRNA expression level in sh-Chi3l1-MSCs. I: Protein level of Chi3l1 in sh-Chi3l1-MSCs detected by Western blotting. **P<0.01 vs sh-NC-MSCs.

Fig.2 Chi3l1 knockdown attenuates therapeutic efficacy of MSCs in T1DM mice. A: Blood glucose levels of the mice in each group over the course of treatment. B: Body weight changes of the mice in each group (*P<0.05, **P<0.01, ***P<0.001 vs T1DM group; #P<0.05, ##P<0.01 vs sh-NC-MSCs group). C: Pancreatic pathological changes in each group (HE staining, original magnification: ×100). D: Insulin content in the pancreas of the mice in each group detected by immunohistochemical staining (×100).

Fig.3 Changes in insulin content and macrophage infiltration in pancreatic tissues of mice. A: Insulin content (green) and macrophage infiltration (red) in pancreatic tissues of mice from each group detected by immunofluorescence staining (×200). B. Statistical analysis of insulin content within individual islets of mice in each group. C: Quantitative analysis of the mean immunofluorescence intensity of macrophages in pancreatic tissues across the groups. **P<0.01,***P<0.001 vs NC group; #P<0.05, ###P<0.001 vs T1DM group; ▲P<0.05 vs sh-NC-MSCs group.

Fig.4 Chi3l1 influences hUC-MSCs-mediated regulation of macrophage polarization. A: Frequency of M1-type macrophages analyzed using flow cytometry. B: Frequency of M2-type macrophages analyzed using flow cytometry. C: Expression of iNOS mRNA detected with qPCR. D: Expressions of mRNAs for inflammatory cytokines detected by qPCR. E: Expression of Arg-1 mRNA detected with qPCR. F: Expressions of mRNAs for anti-inflammatory cytokines detected by qPCR. *P<0.05, **P<0.01 vs Mφ group; #P<0.05 vs sh-NC-MSCs group.

References 32

[1]	Zimmet P, Alberti KG, Magliano DJ, et al. Diabetes mellitus statistics on prevalence and mortality: facts and fallacies[J]. Nat Rev Endocrinol, 2016, 12(10): 616-22. doi：10.1038/nrendo.2016.105
[2]	Harjutsalo V, Maric-Bilkan C, Forsblom C, et al. Impact of sex and age at onset of diabetes on mortality from ischemic heart disease in patients with type 1 diabetes[J]. Diabetes Care, 2014, 37(1): 144-8. doi：10.2337/dc13-0377
[3]	Hummel S, Weiß A, Bonifacio E, et al. Associations of breastfeeding with childhood autoimmunity, allergies, and overweight: The Environmental Determinants of Diabetes in the Young (TEDDY) study[J]. Am J Clin Nutr, 2021, 114(1): 134-42. doi：10.1093/ajcn/nqab065
[4]	Rewers M, Ludvigsson J. Environmental risk factors for type 1 diabetes[J]. Lancet, 2016, 387(10035): 2340-8. doi：10.1016/s0140-6736(16)30507-4
[5]	Shi M, Liu ZW, Wang FS. Immunomodulatory properties and therapeutic application of mesenchymal stem cells[J]. Clin Exp Immunol, 2011, 164(1): 1-8. doi：10.1111/j.1365-2249.2011.04327.x
[6]	Schwartz YS, Svistelnik AV. Functional phenotypes of macrophages and the M1-M2 polarization concept. Part I. Proinflammatory phenotype[J]. Biochemistry (Mosc), 2012, 77(3): 246-60. doi：10.1134/s0006297912030030
[7]	Coulson-Thomas VJ, Coulson-Thomas YM, Gesteira TF, et al. Extrinsic and intrinsic mechanisms by which mesenchymal stem cells suppress the immune system[J]. Ocul Surf, 2016, 14(2): 121-34. doi：10.1016/j.jtos.2015.11.004
[8]	周娜, 刘伟江, 李苹, 等. 间充质干细胞通过调控巨噬细胞极化减轻1型糖尿病模型小鼠炎症反应[J]. 中国药理学与毒理学杂志, 2018, 32(11): 876-84.
[9]	Zhao T, Su ZP, Li YC, et al. Chitinase-3 like-protein-1 function and its role in diseases[J]. Signal Transduct Target Ther, 2020, 5(1): 201. doi：10.1038/s41392-020-00303-7
[10]	Chen YL, Zhang SY, Wang QZ, et al. Tumor-recruited M2 macrophages promote gastric and breast cancer metastasis via M2 macrophage-secreted CHI3L1 protein[J]. J Hematol Oncol, 2017, 10(1): 36. doi：10.1186/s13045-017-0408-0
[11]	Liu QL, Chen XY, Liu C, et al. Mesenchymal stem cells alleviate experimental immune-mediated liver injury via chitinase 3-like protein 1-mediated T cell suppression[J]. Cell Death Dis, 2021, 12(3): 240. doi：10.1038/s41419-021-03524-y
[12]	Furman BL. Streptozotocin-induced diabetic models in mice and rats[J]. Curr Protoc, 2021, 1(4): e78. doi：10.1002/cpz1.78
[13]	Tang YJ, Zhang Z, Yan T, et al. Irisin attenuates type 1 diabetic cardiomyopathy by anti-ferroptosis via SIRT1-mediated deacetylation of p53[J]. Cardiovasc Diabetol, 2024, 23(1): 116. doi：10.1186/s12933-024-02183-5
[14]	Cho DI, Kim MR, Jeong HY, et al. Mesenchymal stem cells reciprocally regulate the M1/M2 balance in mouse bone marrow-derived macrophages[J]. Exp Mol Med, 2014, 46(1): e70. doi：10.1038/emm.2013.135
[15]	Trouplin V, Boucherit N, Gorvel L, et al. Bone marrow-derived macrophage production[J]. J Vis Exp, 2013(81): e50966. doi：10.3791/50966-v
[16]	Pugliese A. Insulitis in the pathogenesis of type 1 diabetes[J]. Pediatr Diabetes, 2016, 17(Suppl Suppl 22): 31-6. doi：10.1111/pedi.12388
[17]	Scherm MG, Wyatt RC, Serr I, et al. Beta cell and immune cell interactions in autoimmune type 1 diabetes: How they meet and talk to each other[J]. Mol Metab, 2022, 64: 101565. doi：10.1016/j.molmet.2022.101565
[18]	Bottino R, Knoll MF, Knoll CA, et al. The future of islet transplantation is now[J]. Front Med (Lausanne), 2018, 5: 202. doi：10.3389/fmed.2018.00202
[19]	Verhoeff K, Marfil-Garza BA, James Shapiro AM. Update on islet cell transplantation[J]. Curr Opin Organ Transplant, 2021, 26(4): 397-404. doi：10.1097/mot.0000000000000891
[20]	Li CH, Gao QY, Jiang H, et al. Changes of macrophage and CD4⁺ T cell in inflammatory response in type 1 diabetic mice[J]. Sci Rep, 2022, 12(1): 14929. doi：10.1038/s41598-022-19031-9
[21]	Höglund P, Mintern J, Waltzinger C, et al. Initiation of autoimmune diabetes by developmentally regulated presentation of islet cell antigens in the pancreatic lymph nodes[J]. J Exp Med, 1999, 189(2): 331-9. doi：10.1084/jem.189.2.331
[22]	Mallone R, Brezar V, Boitard C. T cell recognition of autoantigens in human type 1 diabetes: clinical perspectives[J]. Clin Dev Immunol, 2011, 2011: 513210. doi：10.1155/2011/513210
[23]	Coope A, Torsoni AS, Velloso LA. Mechanisms in endocrinology: Metabolic and inflammatory pathways on the pathogenesis of type 2 diabetes[J]. Eur J Endocrinol, 2016, 174(5): R175-87. doi：10.1530/eje-15-1065
[24]	Calderon B, Suri A, Unanue ER. In CD4⁺ T-cell-induced diabetes, macrophages are the final effector cells that mediate islet beta-cell killing: studies from an acute model[J]. Am J Pathol, 2006, 169(6): 2137-47. doi：10.2353/ajpath.2006.060539
[25]	Wang FX, Sun F, Luo JH, et al. Loss of ubiquitin-conjugating enzyme E2 (Ubc9) in macrophages exacerbates multiple low-dose streptozotocin-induced diabetes by attenuating M2 macrophage polarization[J]. Cell Death Dis, 2019, 10(12): 892. doi：10.1038/s41419-019-2130-z
[26]	Sicco CL, Reverberi D, Balbi C, et al. Mesenchymal stem cell-derived extracellular vesicles as mediators of anti-inflammatory effects: endorsement of macrophage polarization[J]. Stem Cells Transl Med, 2017, 6(3): 1018-28. doi：10.1002/sctm.16-0363
[27]	Zhang CY, Han X, Yang L, et al. Circular RNA circPPM1F modulates M1 macrophage activation and pancreatic islet inflammation in type 1 diabetes mellitus[J]. Theranostics, 2020, 10(24): 10908-24. doi：10.7150/thno.48264
[28]	Zhao JX, Li XL, Hu JX, et al. Mesenchymal stromal cell-derived exosomes attenuate myocardial ischaemia-reperfusion injury through miR-182-regulated macrophage polarization[J]. Cardio-vasc Res, 2019, 115(7): 1205-16. doi：10.1093/cvr/cvz040
[29]	Liu F, Qiu HB, Xue M, et al. MSC-secreted TGF-β regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway[J]. Stem Cell Res Ther, 2019, 10(1): 345. doi：10.1186/s13287-019-1447-y
[30]	Freytes DO, Kang JW, Marcos-Campos I, et al. Macrophages modulate the viability and growth of human mesenchymal stem cells[J]. J Cell Biochem, 2013, 114(1): 220-9. doi：10.1002/jcb.24357
[31]	Ma B, Herzog EL, Lee CG, et al. Role of chitinase 3-like-1 and semaphorin 7a in pulmonary melanoma metastasis[J]. Cancer Res, 2015, 75(3): 487-96. doi：10.1158/0008-5472.can-13-3339
[32]	Cohen N, Shani O, Raz Y, et al. Fibroblasts drive an immunosuppressive and growth-promoting microenvironment in breast cancer via secretion of Chitinase 3-like 1[J]. Oncogene, 2017, 36(31): 4457-68. doi：10.1038/onc.2017.65