Quercetin mediates the therapeutic effect of Centella asiatica on psoriasis by regulating STAT3 phosphorylation to inhibit the IL-23/IL-17A axis

doi:10.12122/j.issn.1673-4254.2025.01.12

Abstract

Abstract:

Objective To explore the active components that mediate the therapeutic effect of Centella asiatica on psoriasis and their therapeutic mechanisms. Methods TCMSP, TCMIP, PharmMapper, Swiss Target Prediction, GeneCards, OMIM and TTD databases were searched for the compounds in Centella asiatica and their targets and the disease targets of psoriasis. A drug-active component-target network and the protein-protein interaction network were constructed, and DAVID database was used for pathway enrichment analysis. In a RAW264.7 macrophage model of LPS-induced inflammation, the anti-inflammatory effect of 7.5, 15, 30, and 60 μmol/L quercetin, asiaticoside, and asiatic acid, which were identified as the main active components in Centella asiatica, were tested by measuring cellular production of NO, TNF‑α and IL-6 using Griess method and ELISA and by detecting mRNA expressions of IL-23, IL-17A, TNF-α and IL-6 and protein expressions of p-STAT3 (Tyr705) and p-STAT3 (Ser727) with RT-qPCR and Western blotting. Results A total of 139 targets of Centella asiatica and 4604 targets of psoriasis were obtained, and among them CASP3, EGFR, PTGS2, and ESR1 were identified as the core targets. KEGG analysis suggested that quercetin, asiaticoside, and asiatic acid in Centella asiatica were involved in cancer and IL-17 and MAPK signaling pathways. In the RAW264.7 macrophage model of inflammation, treatment with quercetin significantly reduced cellular production of NO, TNF‑α and IL-6, and lowered mRNA expressions of IL-23, IL-17A, TNF‑α and IL-6 and protein expressions of p-STAT3 (Tyr705) and p-STAT3 (Ser727). Conclusion Quercetin, asiaticoside and asiatic acid are the main active components in Centella asiatica to mediate the therapeutic effect against psoriasis, and quercetin in particular is capable of suppressing cellular production of NO, TNF‑α and IL-6 and regulating the IL-23/IL-17A inflammatory axis by mediating STAT3 phosphorylation to inhibit inflammatory response.

Key words: Centella asiatica, psoriasis, quercetin, IL-23/IL-17A, network pharmacology

Qing LIU, Jing LIU, Yihang ZHENG, Jin LEI, Jianhua HUANG, Siyu LIU, Fang LIU, Qunlong PENG, Yuanfang ZHANG, Junjie WANG, Yujuan LI. Quercetin mediates the therapeutic effect of Centella asiatica on psoriasis by regulating STAT3 phosphorylation to inhibit the IL-23/IL-17A axis[J]. Journal of Southern Medical University, 2025, 45(1): 90-99.

Figures/Tables 10

Tab.1 Primer sequences for real-time fluorescence quantitative PCR

Gene	Primer sequences (5'-3')-F	Primer sequences (5'-3')-R	Length (bp)
GAPDH	AGGTCGGTGTGAACGGATTTG	TGTAGACCATGTAGTTGAGGTCA	123
IL-23	GTGGCATCGAGAAACTGT	GAGCCACCCAGGAAAGTA	116
IL-17A	ACTACCTCAACCGTTCCACG	TTCCTCCGCATTGACACAG	120
TNF-α	ATGAGCACAGAAAGCATGATC	GGTCTGGGCCATAGAACTGATG	231
IL-6	TAGTCCTTCCTACCCCAATTTCC	TTGGTCCTTAGCCACTCCTTC	76

Tab.2 Basic information of the active components in Centella asiatica

Number	MOL ID	Compound Name	Oral Bioavailability	Drug Likeness
A 1	MOL000098	Quercetin	46.43	0.28
A 2	MOL007312	Asiaticoside	10.22	0.7
A 3	MOL007253	Asiatic acid	16.69	0.72
A 4	MOL000359	Sitosterol	36.91	0.75
A 5	MOL007313	Xanthanoic acid	48.07	0.16
A 6	MOL007320	8-acetoxycentellynol	65.94	0.12
A 7	MOL006370	5-O-caffeoylquinic acid	19.61	0.33
A 8	MOL000008	Qpigenin	23.06	0.21
A 9	MOL007201	Brahmic acid	17.6	0.7
A 10	MOL006387	Chlorogenic acid	25.58	0.33
A 11	MOL007323	Madasiatic acid	18.42	0.72
A 12	MOL007303	Madecassoside	16.89	0.7
A 13	MOL006407	Neochlorogenic acid	18.05	0.33
A 14	MOL001434	Quercetin 3-O-rhamnopyranosyl	22.24	0.28
A 15	MOL000511	Ursolic acid	16.77	0.75

Fig. 1 Venn diagram of the active components of Centella asiatica-psoriasis target.

Fig.2 Drug-active ingredient-targets and PPI network diagram. A: Drug-active ingredient-targets network diagram. B: PPI network diagram. C: Core targets network diagram.

Fig. 3 GO functional annotation and KEGG signal pathway analysis of the anti-psoriasis effect of Centella asiatica. A: GO functional annotation. B: KEGG signal pathway analysis.

Fig.4 Effect of active components in Centella asiatica on the growth of RAW264.7 cells. A-C: Effects of Que, Asi, and Asi acid on viability of RAW264.7 cells. D-F: Effects of Que, Asi, and Asi acid on viability of RAW264.7 cells treated with LPS (100 ng/mL). *P<0.05, **P<0.01 vs Control group.

Fig. 5 Effect of Que (A), Asi (B) and Asi acid (C) on NO levels in the cell culture media of LPS-induced RAW264.7 cells determined by Griess assay. ##P<0.01 vs Control group, *P<0.05, **P<0.01 vs LPS group.

Fig. 6 Inhibitory effects of Que on secretion of TNF-α (A) and IL-6 (B) in LPS-induced RAW264.7 cells. ##P<0.01 vs Control group, *P<0.05, **P<0.01 vs LPS group.

Fig. 7 Inhibitory effects of Que on mRNA expressions of IL-23 (A), IL-17A (B), TNF-α (C), and IL-6 (D) in LPS-induced RAW264.7 cells. ##P<0.01 vs Control group, *P<0.05, **P<0.01 vs LPS group.

Fig. 8 Effect of Que on STAT3 protein phosphorylation in LPS-induced RAW264.7 cells. A: Western blotting for detecting expressions of STAT3, p-STAT3 (Tyr705), and p-STAT3 (Ser727). B-D: Semi-quantitative analysis of STAT3, p-STAT3(Tyr705), and p-STAT3(Ser727) expression levels. ##P<0.01 vs Control group, *P<0.05, **P<0.01 vs LPS group.

References 41

1	Boehncke WH, Schön MP. Psoriasis[J]. Lancet (London, England), 2015, 386(9997): 983-94.
2	Raharja A, Mahil SK, Barker JN. Psoriasis: a brief overview[J]. Clin Med, 2021, 21(3): 170-3.
3	Takuathung MN, Potikanond S, Sookkhee S, et al. Anti-psoriatic and anti-inflammatory effects of Kaempferia parviflora in keratinocytes and macrophage cells[J]. Biomedecine Pharmacother, 2021, 143: 112229.
4	Kim SY, Han SD, Kim M, et al. Mentha arvensis essential oil exerts anti-inflammatory in LPS-stimulated inflammatory responses via inhibition of ERK/NF‑κB signaling pathway and anti-atopic dermatitis-like effects in 2, 4-dinitrochlorobezene-induced BALB/c mice[J]. Antioxidants, 2021, 10(12): 1941.
5	Li PH, Li YL, Jiang H, et al. Glabridin, an isoflavan from licorice root, ameliorates imiquimod-induced psoriasis-like inflammation of BALB/c mice[J]. Int Immunopharmacol, 2018, 59: 243-51.
6	Tan RZ, Zhong X, Han RY, et al. Macrophages mediate psoriasis via Mincle-dependent mechanism in mice[J]. Cell Death Discov, 2023, 9(1): 140.
7	Kamata M, Tada Y. Dendritic cells and macrophages in the pathogenesis of psoriasis[J]. Front Immunol, 2022, 13: 941071.
8	Tokuyama M, Mabuchi T. New treatment addressing the pathogenesis of psoriasis[J]. Int J Mol Sci, 2020, 21(20): 7488.
9	Silvagni E, Missiroli S, Perrone M, et al. From bed to bench and back: TNF‑α, IL-23/IL-17A, and JAK-dependent inflammation in the pathogenesis of psoriatic synovitis[J]. Front Pharmacol, 2021, 12: 672515.
10	Brembilla NC, Senra L, Boehncke WH. The IL-17 family of cytokines in psoriasis: IL-17A and beyond[J]. Front Immunol, 2018, 9: 1682.
11	Sharma A, Upadhyay DK, Gupta GD, et al. IL-23/Th17 axis: a potential therapeutic target of psoriasis[J]. Curr Drug Res Rev, 2022, 14(1): 24-36.
12	Di Cesare A, Di Meglio P, Nestle FO. The IL-23/Th17 axis in the immunopathogenesis of psoriasis[J]. J Invest Dermatol, 2009, 129(6): 1339-50.
13	Reid C, Griffiths CEM. Psoriasis and treatment: past, present and future aspects[J]. Acta Derm Venereol, 2020, 100(3): adv00032.
14	Bakshi H, Nagpal M, Singh M, et al. Treatment of psoriasis: a comprehensive review of entire therapies[J]. Curr Drug Saf, 2020, 15(2): 82-104.
15	Gohil KJ, Patel JA, Gajjar AK. Pharmacological review on Centella asiatica: a potential herbal cure-all[J]. Indian J Pharm Sci, 2010, 72(5): 546-56.
16	Lin P, Shi HY, Lu YY, et al. Centella asiatica alleviates psoriasis through JAK/STAT3-mediated inflammation: an in vitro and in vivo study[J]. J Ethnopharmacol, 2023, 317: 116746.
17	Dagar N, Kale A, Jadhav HR, et al. Nutraceuticals and network pharmacology approach for acute kidney injury: a review from the drug discovery aspect[J]. Fitoterapia, 2023, 168: 105563.
18	Su YY, Bai Q, Tao HX, et al. Prospects for the application of traditional Chinese medicine network pharmacology in food science research[J]. J Sci Food Agric, 2023, 103(11): 5183-200.
19	Dai HB, Shan Y, Yu MS, et al. Network pharmacology, molecular docking and experimental verification of the mechanism of huangqi-jixuecao herb pair in treatment of peritoneal fibrosis[J]. J Ethnopharmacol, 2024, 318(Pt A): 116874.
20	Bhoir SS, Vishwapathi V, Singh KK. Antipsoriatic potential of Annona squamosa seed oil: an in vitro and in vivo evaluation[J]. Phytomedicine, 2019, 54: 265-77.
21	Ayoub R, Jilani J, Jarrar Q, et al. Synthesis and In-vivo evaluation of benzoxazole derivatives as promising anti-psoriatic drugs for clinical use[J]. Molecules, 2022, 27(9): 3023.
22	Liu Q, Xiao XH, Hu LB, et al. Anhuienoside C ameliorates collagen-induced arthritis through inhibition of MAPK and NF‑κB signaling pathways[J]. Front Pharmacol, 2017, 8: 299.
23	Rendon A, Schäkel K. Psoriasis pathogenesis and treatment[J]. Int J Mol Sci, 2019, 20(6): 1475.
24	Guo J, Zhang HY, Lin WR, et al. Signaling pathways and targeted therapies for psoriasis[J]. Signal Transduct Target Ther, 2023, 8(1): 437.
25	Wu MJ, Dai C, Zeng FF. Cellular mechanisms of psoriasis pathogenesis: a systemic review[J]. Clin Cosmet Investig Dermatol, 2023, 16: 2503-15.
26	Armstrong AW, Read C. Pathophysiology, clinical presentation, and treatment of psoriasis: a review[J]. JAMA, 2020, 323(19): 1945-60.
27	Lee HJ, Kim M. Challenges and future trends in the treatment of psoriasis[J]. Int J Mol Sci, 2023, 24(17): 13313.
28	Li TT, Gao S, Han W, et al. Potential effects and mechanisms of Chinese herbal medicine in the treatment of psoriasis[J]. J Ethnopharmacol, 2022, 294: 115275.
29	Wang JY, Zhang CS, Zhang AL, et al. Chinese herbal medicine bath therapy for psoriasis vulgaris using topical calcipotriol as the comparator: a systematic review with meta-analysis and association rule analysis[J]. J Ethnopharmacol, 2024, 330: 118166.
30	Lee Y, Choi HK, N'Deh KPU, et al. Inhibitory effect of Centella asiatica extract on DNCB-induced atopic dermatitis in HaCaT cells and BALB/c mice[J]. Nutrients, 2020, 12(2): 411.
31	Ghoreschi K, Balato A, Enerback C, et al. Therapeutics targeting the IL-23 and IL-17 pathway in psoriasis[J]. Lancet, 2021, 397(10275): 754-66.
32	Hawkes JE, Yan BY, Chan TC, et al. Discovery of the IL-23/IL-17 signaling pathway and the treatment of psoriasis[J]. J Immunol, 2018, 201(6): 1605-13.
33	Kukula O, Kırmızıkan S, Tiryaki ES, et al. Asiatic acid exerts an anti-psoriatic effect in the imiquimod-induced psoriasis model in mice[J]. Immunopharmacol Immunotoxicol, 2022, 44(3): 367-72.
34	Wang HL, Peters T, Sindrilaru A, et al. Key role of macrophages in the pathogenesis of CD18 hypomorphic murine model of psoriasis[J]. J Invest Dermatol, 2009, 129(5): 1100-14.
35	Stratis A, Pasparakis M, Rupec RA, et al. Pathogenic role for skin macrophages in a mouse model of keratinocyte-induced psoriasis-like skin inflammation[J]. J Clin Invest, 2006, 116(8): 2094-104.
36	Zhou W, Hu MM, Zang XH, et al. Luteolin attenuates imiquimod-induced psoriasis-like skin lesions in BALB/c mice via suppression of inflammation response[J]. Biomedecine Pharmacother, 2020, 131: 110696.
37	Calautti E, Avalle L, Poli V. Psoriasis: a STAT3-centric view[J]. Int J Mol Sci, 2018, 19(1): 171.
38	Kanda N. Psoriasis: pathogenesis, comorbidities, and therapy updated[J]. Int J Mol Sci, 2021, 22(6): 2979.
39	Kanemaru K, Matsuyuki A, Nakamura Y, et al. Obesity exacerbates imiquimod-induced psoriasis-like epidermal hyperplasia and interleukin-17 and interleukin-22 production in mice[J]. Exp Dermatol, 2015, 24(6): 436-42.
40	Cai L, Jiang CJ, Zhang GQ, et al. A multicentre randomized double-blind placebo-controlled phase III study of the efficacy andsafety ofxeligekimab (GR1501) in patients withmoderate-to-severe plaque psoriasis[J]. Br J Dermatol, 2024, 191(3): 336-43.
41	Dong WL, Nie XY, Wang JX, et al. Randomised, double-blind, multicentre, phase Ⅰ/Ⅱ dose escalation and expansion trial of GR1501 in patients with plaque psoriasis: study protocol[J]. BMJ Open, 2020, 10(11): e039067.

[1]	Qiao CHU, Xiaona WANG, Jiaying XU, Huilin PENG, Yulin ZHAO, Jing ZHANG, Guoyu LU, Kai WANG. Pulsatilla saponin D inhibits invasion and metastasis of triple-negative breast cancer cells through multiple targets and pathways [J]. Journal of Southern Medical University, 2025, 45(1): 150-161.
[2]	Xiupeng LONG, Shun TAO, Shen YANG, Suyun LI, Libing RAO, Li LI, Zhe ZHANG. Quercetin improves heart failure by inhibiting cardiomyocyte apoptosis via suppressing the MAPK signaling pathway [J]. Journal of Southern Medical University, 2025, 45(1): 187-196.
[3]	Meng XU, Lina CHEN, Jinyu WU, Lili LIU, Mei SHI, Hao ZHOU, Guoliang ZHANG. Mechanism of Hedyotis diffusa-Scutellaria barbata D. Don for treatment of primary liver cancer: analysis with network pharmacology, molecular docking and in vitro validation [J]. Journal of Southern Medical University, 2025, 45(1): 80-89.
[4]	Yifan JIANG, Xiaorong LI, Jiayi GENG, Yongfeng CHEN, Bi TANG, Pinfang KANG. Quercetin ameliorates diabetic kidney injury in rats by inhibiting the HMGB1/RAGE/ NF-κB signaling pathway [J]. Journal of Southern Medical University, 2024, 44(9): 1769-1775.
[5]	Xingmei CHEN, Qinwen LIU, Yi LI, Xiaoyu ZHONG, Qiling FAN, Ke MA, Liuting LUO, Daogang GUAN, Zhibo ZHU. Analysis of core functional components in Yinchenhao Decoction and their pathways for treating liver fibrosis [J]. Journal of Southern Medical University, 2024, 44(8): 1508-1517.
[6]	Shanyuan ZHANG, Qiaoyan CAI, Jianghan QI, Kaixin YIN, Chenchen HE, Zhuye GAO, Ling ZHANG, Jianfeng CHU. Pharmacodynamics of Qingxin Jieyu Granules for treatment of atherosclerosis and its regulatory mechanism for lipid metabolism [J]. Journal of Southern Medical University, 2024, 44(8): 1518-1528.
[7]	Yuming ZHANG, Shicheng XIA, Linlin ZHANG, Mengxi CHEN, Xiaojing LIU, Qin GAO, Hongwei YE. Protective effect of Lonicerae japonicae flos extract against doxorubicin-induced liver injury in mice [J]. Journal of Southern Medical University, 2024, 44(8): 1571-1581.
[8]	Jinjin WANG, Wenfei CUI, Xuewei DOU, Binglei YIN, Yuqi NIU, Ling NIU, Guoli YAN. Euonymus alatus delays progression of diabetic kidney disease in mice by regulating EGFR tyrosine kinase inhibitor resistance signaling pathway [J]. Journal of Southern Medical University, 2024, 44(7): 1243-1255.
[9]	Linyue WANG, Wenyue QI, Jihua GAO, Maosheng TIAN, Jiancheng XU. Tongyangxiao Lotion promotes postoperative wound healing in a rat model of anal fistula by downregulating inflammatory factors and suppressing inflammation [J]. Journal of Southern Medical University, 2024, 44(7): 1256-1265.
[10]	Wenxiang ZHANG, Huixian GU, Pengde CHEN, Siyu WU, Hongyan MA, Lan YAO. Compound Yuye Decoction protects diabetic rats against cardiomyopathy by inhibiting myocardial apoptosis and inflammation via regulating the PI3K/Akt signaling pathway [J]. Journal of Southern Medical University, 2024, 44(7): 1306-1314.
[11]	Yan HUANG, Lulu QIN, Shaoxing GUAN, Yanping GUANG, Yuru WEI, Ailing CAO, Dongmei LI, Guining WEI, Qibiao SU. Therapeutic mechanism of aqueous extract of Semiliquidambar cathayensis Chang root for pancreatic cancer: the active components, therapeutic targets and pathways [J]. Journal of Southern Medical University, 2024, 44(7): 1336-1344.
[12]	Zhijun REN, Jianxin DIAO, Yiting WANG. Xionggui Decoction alleviates heart failure in mice with myocardial infarction by inhibiting oxidative stress-induced cardiomyocyte apoptosis [J]. Journal of Southern Medical University, 2024, 44(7): 1416-1424.
[13]	Ruibo LI, Ge GAO, Xi XIE, Haibin LUO. Oral submucosal fibrosis induced by active components in areca nut: a network pharmacology-based analysis and validation of the mechanism [J]. Journal of Southern Medical University, 2024, 44(5): 930-940.
[14]	LI Yunfei, YANG Jingyi, ZHANG Ying, ZHANG Caixia, WEI Yuxiang, WANG Yiying, WU Ning, SUN Jianfei, WU Zunqiu. The Miao medicine Sidaxue alleviates rheumatoid arthritis in rats possibly by downregulating matrix metalloproteinases [J]. Journal of Southern Medical University, 2024, 44(4): 739-747.
[15]	CHEN Junjie, HUANG Chuanbing, LI Ming. Jianpi Zishen granule inhibits podocyte autophagy in systemic lupus erythematosus: a network pharmacology and clinical study [J]. Journal of Southern Medical University, 2024, 44(3): 465-473.