Hepatocellular carcinoma cells induce M2 macrophage polarization through upregulation of ANXA2 and ANXA5 expression

doi:10.12122/j.issn.1673-4254.2026.09.10

Abstract

Abstract:

Objective To explore the prognostic value of annexins A2 (ANXA2) and A5 (ANXA5) in hepatocellular carcinoma (HCC) and their impact on tumor microenvironment. Methods Public datasets of HCC transcriptome and clinical data and spatial transcriptomic data were used for survival analysis, correlation analysis, immune microenvironment analysis, and enrichment analysis to explore the effects of annexin A2 (ANXA2) and ANXA5 on patient prognosis and tumor microenvironment and the potential mechanisms. Immunofluorescence assays were performed to detect ANXA2, ANXA5, and ANXA11 expressions in HCC tissues and their co-expression with CD206. THP-1 cells were treated with culture supernatant of human HCC MHCC-97H cells (TCM), and the changes in mRNA levels of IL-10, ANXA2, ANXA5, and ANXA11 and the protein levels of ANXA2, ANXA5, ANXA11, and KLF4 were examined using qRT-PCR and Western blotting. Flow cytometry was used to detect the expression of CD206 and PD-L1 in the macrophages. Results ANXA2, ANXA5 and ANXA11 expressions were all significantly up-regulated in HCC tissues in correlation with poor patient prognosis. GO and GSEA revealed enrichment of IL-10 and IL-4/IL-13 signaling pathways in tumors overexpressing ANXA2, ANXA5 and ANXA11, whose high expressions were positively correlated with macrophage infiltration. Immunofluorescence staining demonstrated co-expressions of ANXA2 and ANXA5 with M2-macrophage markers in human HCC tissues. The conditioned medium from HCC cells significantly up-regulated the expressions of ANXA2, ANXA5, CD206 and PD-L1 in THP-1 cells, whereas treatment with the recombinant ANXA2 or ANXA5 protein alone increased CD206 expression only. Correlation analysis indicated that KLF4 was positively correlated with both ANXA2 and ANXA5, and inhibition of KLF4 caused significant reduction of ANXA2, ANXA5 and CD206 levels in THP-1 cells. Conclusion HCC promotes M2 macrophage polarization by up-regulating ANXA2 and ANXA5 expressions, which contribute to an immunosuppressive microenvironment in HCC and potentially serve as molecular targets for HCC immunotherapy.

Key words: hepatocellular carcinoma, annexin A2, annexin A5, Tumor-Associated Macrophage, CD206

Junying XU, Chenghao LIU, Hao HUANG, Huijiao JIANG, Dan DONG, Xiangwei WU, Xueling CHEN. Hepatocellular carcinoma cells induce M2 macrophage polarization through upregulation of ANXA2 and ANXA5 expression[J]. Journal of Southern Medical University, 2026, 46(9): 2101-2112.

Figures/Tables 9

Tab.1 Primer sequence for qRT-PCR

Gene	Primer (5'-3')
ANXA2	F: ATATTGCCTTCGCCTACCAGAG R: GCGTCATACTGAGCAGGTGTCTT
ANXA5	F: GACTTCCCTGGATTTGATGAGC R: GAGGGTTTCATCAGAGCCACAA
ANXA11	F: AAAGGCTTCGGGACGGAT R: AGCCGTCTTGAAGGAAAGTAGGAT
IL-10	F: CTCCGAGATGCCTTCAGCAG R: TCACATGCGCCTTGATGTCT
β-actin	F: CACCCAGCACAATGAAGATCAAGAT R: CCAGTTTTTAAATCCTGAGTCAAGC

Fig.1 Expression of ANXA2, ANXA5, and ANXA11 in hepatocellular carcinoma (HCC) and their association with prognosis. A, B: ANXA family expression in HCC. C, E: Analysis of the association between the ANXA family and prognosis of HCC. D: PPI network analysis of molecular functional relationships within the ANXA family. *P<0.05, **P<0.01, ***P<0.001

Fig.2 Spatial transcriptomic analysis of ANXA2, ANXA5, and ANXA11 mRNA levels in HCC. A-H: Spatial transcriptomic analysis of ANXA2, ANXA5, and ANXA11 mRNA levels in non-malignant (nMal) and malignant (Mal) regions of HCC tissue. ***P<0.001 vs nMal.

Fig.3 Correlation between expression levels of ANXA2, ANXA5, and ANXA11 and immune cell infiltration. A, C, E: ssGSEA analysis of ANXA2, ANXA5 and ANXA11 mRNA levels in relation to immune-cell infiltration. B, D, F: Spatial transcriptomic analysis of ANXA2, ANXA5 and ANXA11 mRNA levels in relation to immune-cell infiltration.

Fig.4 Correlation of ANXA2, ANXA5, and ANXA11 with immunosuppressive and adhesion gene expression. A-C: Top 30 co-expressed gene profiling analysis of ANXA2, ANXA5, and ANXA11. D: PPI-based interactome analysis of ANXA2, ANXA5, and ANXA11 together with their top 30 co-expressed genes.

Fig.5 ANXA2, ANXA5, and ANXA11 are associated with IL-4/IL-13 and PD-1 signaling pathways. A, B: GO functional annotation and GSEA enrichment analysis of ANXA2, ANXA5, and ANXA11.

Fig.6 Expression of ANXA2, ANXA5, and ANXA11 in HCC tissues. A-C: Immunofluorescence staining of the co-expression of ANXA2, ANXA5, and ANXA11 with CD206 in HCC tissues. D, E: mRNA and protein levels of ANXA2, ANXA5, and ANXA11 (n=3). CON: Control; TCM: Tumor conditioned medium. **P<0.01, ***P<0.001 vs CON group.

Fig.7 ANXA2 and ANXA5 induce the expression of the M2 macrophage marker CD206. A-C: flow cytometric analysis of CD206 (n=5), PD-L1 (n=5) expression and IL-10 (n=3) mRNA levels in THP-1 cells after treatment with tumor-conditioned medium (TCM). D-F: CD206, PD-L1 expression and IL-10 mRNA level in THP-1 cells induced by ANXA2 and ANXA5 (n=3). ***P<0.001 vs CON group.

Fig.8 TCM of MHCC-97H cells promotes ANXA2 and ANXA5 expression in THP-1 cells by upregulating KLF4. A: Correlation analysis of ANXA2, ANXA5, and KLF4 mRNA levels using TCGA-LIHC transcriptome data (n=3). B, C: Protein levels of KLF4, ANXA2, and ANXA5 of THP-1 cells treated by TCM and Kenpaullone (n=3). D, E: Flow cytometric analysis of CD206 and PD-L1 expression in THP-1 cells (n=4). Ken: Kenpaullone. *P<0.05, ***P<0.001 vs CON group; ##P<0.01, #P<0.05 vs TCM group.

References 26

[1]	Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA A Cancer J Clin, 2024, 74(3): 229-63. doi：10.3322/caac.21834
[2]	Vogel A, Meyer T, Sapisochin G, et al. Hepatocellular carcinoma[J]. Lancet, 2022, 400(10360): 1345-62. doi：10.1016/s0140-6736(22)01200-4
[3]	Danpanichkul P, Duangsonk K, Chen VL, et al. Global burden of HBV-related liver disease: Primary liver cancer due to chronic HBV infection increased in over one-third of countries globally from 2000 to 2021[J]. Hepatology, 2025, 82(5): 1274-86. doi：10.1097/hep.0000000000001260
[4]	Khatun M, Ray R, Ray RB. Hepatitis C virus associated hepatocellular carcinoma[J]. Adv Cancer Res, 2021, 149: 103-42. doi：10.1016/bs.acr.2020.10.003
[5]	Vitellius C, Desjonqueres E, Lequoy M, et al. MASLD-related HCC: Multicenter study comparing patients with and without cirrhosis[J]. JHEP Rep, 2024, 6(10): 101160. doi：10.1016/j.jhepr.2024.101160
[6]	Wang WY, Wei C. Advances in the early diagnosis of hepatocellular carcinoma[J]. Genes Dis, 2020, 7(3): 308-19. doi：10.1016/j.gendis.2020.01.014
[7]	Singal AG, Zhang E, Narasimman M, et al. HCC surveillance improves early detection, curative treatment receipt, and survival in patients with cirrhosis: a meta-analysis[J]. J Hepatol, 2022, 77(1): 128-39. doi：10.1016/j.jhep.2022.01.023
[8]	Xu WQ, Cheng YL, Guo YH, et al. Targeting tumor associated macrophages in hepatocellular carcinoma[J]. Biochem Pharmacol, 2022, 199: 114990. doi：10.1016/j.bcp.2022.114990
[9]	Li DM, Zhang T, Guo Y, et al. Biological impact and therapeutic implication of tumor-associated macrophages in hepatocellular carcinoma[J]. Cell Death Dis, 2024, 15: 498. doi：10.1038/s41419-024-06888-z
[10]	Singer M, Zhang ZL, Dayyani F, et al. Modulation of tumor-associated macrophages to overcome immune suppression in the hepatocellular carcinoma microenvironment[J]. Cancers, 2024, 17(1): 66. doi：10.3390/cancers17010066
[11]	Chu XY, Tian Y, Lv C. Decoding the spatiotemporal heterogeneity of tumor-associated macrophages[J]. Mol Cancer, 2024, 23(1): 150. doi：10.1186/s12943-024-02064-1
[12]	Nosaka T, Murata Y, Takahashi K, et al. Hepatocellular carcinoma progression promoted by 5-lipoxygenase activity in CD163⁺ tumor-associated macrophages[J]. Biomed Pharmacother, 2023, 162: 114592. doi：10.1016/j.biopha.2023.114592
[13]	Wu QC, Zhou WH, Yin SY, et al. Blocking triggering receptor expressed on myeloid cells-1-positive tumor-associated macrophages induced by hypoxia reverses immunosuppression and anti-programmed cell death ligand 1 resistance in liver cancer[J]. Hepatology, 2019, 70(1): 198-214. doi：10.1002/hep.30593
[14]	Waki Y, Morine Y, Saito Y, et al. Lenvatinib-resistant hepatocellular carcinoma promotes malignant potential of tumor-associated macrophages via exosomal miR-301a-3p[J]. Ann Gastroenterol Surg, 2024, 8(6): 1084-95. doi：10.1002/ags3.12814
[15]	Song ZH, Wang X, Liu XH, et al. Targeting of Annexin A1 in Tumor-associated Macrophages as a therapeutic strategy for hepatocellular carcinoma[J]. Biochem Pharmacol, 2023, 213: 115612. doi：10.1016/j.bcp.2023.115612
[16]	Wen YJ, Zhou WH, Zhao ZZ, et al. Annexin A’s life in pan-cancer: especially in glioma immune cells[J]. NeuroMolecular Med, 2025, 27(1): 17. doi：10.1007/s12017-024-08827-9
[17]	Xu F, Guo MM, Huang W, et al. Annexin A5 regulates hepatic macrophage polarization via directly targeting PKM2 and ameliorates NASH[J]. Redox Biol, 2020, 36: 101634. doi：10.1016/j.redox.2020.101634
[18]	Shao X, Xu PC, Ji LL, et al. Low-dose decitabine promotes M2 macrophage polarization in patients with primary immune thrombocytopenia via enhancing KLF4 binding to PPARγ promoter[J]. Clin Transl Med, 2023, 13(7): e1344. doi：10.1002/ctm2.1344
[19]	Pan Y, Hui XY, Hoo RLC, et al. Adipocyte-secreted exosomal microRNA-34a inhibits M2 macrophage polarization to promote obesity-induced adipose inflammation[J]. J Clin Investig, 2019, 129(2): 834-49. doi：10.1172/jci123069
[20]	Dong S, Li X, Chen Z, et al. MMP28 recruits M2-type tumor-associated macrophages through MAPK/JNK signaling pathway-dependent cytokine secretion to promote the malignant progression of pancreatic cancer[J]. J Exp Clin Cancer Res, 2025, 44(1): 60. doi：10.1186/s13046-025-03321-x
[21]	Kang BJ, Jia ZX, Dong YS, et al. Recombinant human annexin A5 accelerates diabetic wounds healing by regulating skin inflammation[J]. Regen Ther, 2024, 27: 342-53. doi：10.1016/j.reth.2024.03.013
[22]	Ma YZ, Wu L, Liu XW, et al. KLF4 inhibits colorectal cancer cell proliferation dependent on NDRG2 signaling[J]. Oncol Rep, 2017, 38(2): 975-84. doi：10.3892/or.2017.5736
[23]	Li Y, Feng RY, Yu X, et al. SLC35E2 promoter mutation as a prognostic marker of esophageal squamous cell carcinoma[J]. Life Sci, 2022, 296: 120447. doi：10.1016/j.lfs.2022.120447
[24]	Wu DH, Liang H, Wang H, et al. Hepatitis B virus-X protein regulates high mobility group box 1 to promote the formation of hepatocellular carcinoma[J]. Oncol Lett, 2018, 16(4): 4418-26.
[25]	Peng X, Zhu YY, Han YQ, et al. Enhancing anti-tumor immunity by targeting BATF and the STAT1/PD-L1 pathway in cervical carcinoma[J]. Cell Mol Life Sci, 2025, 82(1): 353. doi：10.1007/s00018-025-05792-9
[26]	van Duijn A, Willemsen KJ, van Uden NOP, et al. A secondary role for hypoxia and HIF1 in the regulation of (IFNγ-induced) PD-L1 expression in melanoma[J]. Cancer Immunol Immunother, 2022, 71(3): 529-40. doi：10.1007/s00262-021-03007-1