High STING expression exacerbates renal ischemia-reperfusion injury in mice by regulating the TLR4/NF-κB/NLRP3 pathway and promoting inflammation and apoptosis

doi:10.12122/j.issn.1673-4254.2024.07.14

Abstract

Abstract:

Objective To investigate renal expression level of STING in mice with renal ischemia-reperfusion injury (IRI) and its regulatory role in IRI. Methods C57BL/6 mice were divided into sham operation group, IRI (induced by clamping the renal artery) model group, IRI+DMSO treatment group, and IRI+SN-011 treatment group. Serum creatinine and blood urea nitrogen of the mice were analyzed, and pathological changes in the renal tissue were assessed with PAS staining. RT-qPCR, ELISA, Western blotting, and immunohistochemistry were used to detect the expression levels of STING, KIM-1, Bcl-2, Bax, caspase-3, TLR4, P65, NLRP3, caspase-1, CD68, MPO, IL-1β, IL-6, and TNF-α in the renal tissues. In the cell experiment, HK-2 cells exposed to hypoxia-reoxygenation (H/R) were treated with DMSO or SN-011, and cellular STING expression levels and cell apoptosis were analyzed using RT-qPCR, Western blotting or flow cytometry. Results In C57BL/6 mice, renal IRI induced obvious renal tissue damage, elevation of serum creatinine and blood urea nitrogen levels and renal expression levels of KIM-1, STING, TLR4, P65, NLRP3, caspase-1, caspase-3, Bax, CD68, MPO, IL-1β, IL-6, and TNF-α, and reduction of Bcl-2 expression level. Treatment of the mouse models with SN-011 for inhibiting STING expression significantly alleviated these changes. In HK-2 cells, H/R exposure caused significant elevation of cellular STING expression and obviously increased cell apoptosis rate, which was significantly lowered by treatment with SN-011. Conclusion Renal STING expression is elevated in mice with renal IRI to exacerbate renal injury by regulating the TLR4/NF-κB/NLRP3 pathway and promoting inflammation and apoptosis in the renal tissues.

Key words: STING, TLR4, NF-κB, NLRP3, ischemia-reperfusion, inflammation, apotosis

Huaixiang TAO, Jinguang LUO, Zhiyuan WEN, Genming YU, Xiao SU, Xinwei WANG, Han GUAN, Zhijun CHEN. High STING expression exacerbates renal ischemia-reperfusion injury in mice by regulating the TLR4/NF-κB/NLRP3 pathway and promoting inflammation and apoptosis[J]. Journal of Southern Medical University, 2024, 44(7): 1345-1354.

Figures/Tables 5

Tab.1 Primer sequence for RT-qPCR

Gene	Primer sequence
STING	F:GTCCCTTGCACATGGTGTTG
STING	R:CAGGTCATGCTGTCGCCTAT
KIM-1	F:AGAAGACCCACAACTACAAGGC
KIM-1	R:TAGATGTTGGAGGAGTGGAGGT
IL-1β	F:GCCTGTGTTTTCCTCCTTGC
IL-1β	R:TGCTGCCTAATGTCCCCTTG
IL-6	F:GTGGCTAAGGACCAAGACCAT
IL-6	R:TCTGACCACAGTGAGGAATGTC
TNF-α	F:AGCCGATGGGTTGTACCTTG
TNF-α	R:ATAGCAAATCGGCTGACGGT
GAPDH	F:TGGAAAGCTGTGGCGTGAT
GAPDH	R:AGATCCACGACGGACACATT

Fig.2 Serum biochemistry, Western blotting, RT-qPCR and PAS staining for assessing the effect of ischemia-reperfusion modeling. A, B: Serum BUN (A) and Cr (B) levels of the mice in sham and IRI group. C: RT-qPCR analysis of KIM-1 in Sham and IRI groups mice. D: Western blotting of KIM-1 in sham and IRI group. E: PAS staining of renal tissue from mice in sham and IRI groups (Original magnification: ×400). *P<0.05 vs Sham group.

Fig.5 RT-qPCR, Western blotting and PAS staining for detecting renal tissue injury. A: PAS staining of kidney tissues from mice in the sham, IRI, IRI+DMSO and IRI+SN-011 groups (×400). B, C: RT-qPCR and Western blotting of the expressions of KIM-1 in sham, IRI, IRI+DMSO and IRI+SN-011 groups. *P<0.05 vs Sham; #P<0.05 vs IRI.

Fig.7 Cell apoptosis analyzed using Western blotting and flow cytometry. A: Western blotting of relative expression levels of caspase-3, Bcl-2 and Bax in mouse kidney tissue from sham, IRI, IRI+DMSO and IRI+SN-011 groups. B: Flow cytometric analysis of HK-2 cell apoptosis in control, H/R, H/R+DMSO, and H/R+SN-011 groups. *P<0.05 vs Sham; #P<0.05 vs IRI; ▲P<0.05 vs control; ☆P<0.05 vs H/R.

Fig.8 Western blotting for detecting TLR4, NF‑κB P65, NLRP3, and caspase-1 protein expressions in the renal tissue. A: Western blotting of TLR4 and NF-κB P65 in mouse kidney tissues from sham, IRI, IRI+DMSO and IRI+SN-011 groups. B: Western blotting of NLRP3 and caspase-1 in mice kidney tissue from the sham, IRI, IRI+DMSO and IRI+SN-011 groups. *P<0.05 vs Sham; #P<0.05 vs IRI.

References 45

1	Hoste EAJ, Kellum JA, Selby NM, et al. Global epidemiology and outcomes of acute kidney injury[J]. Nat Rev Nephrol, 2018, 14(10): 607-25.
2	Zuk A, Bonventre JV. Acute kidney injury[J]. Annu Rev Med, 2016, 67: 293-307.
3	Arai S, Kitada K, Yamazaki T, et al. Apoptosis inhibitor of macrophage protein enhances intraluminal debris clearance and ameliorates acute kidney injury in mice[J]. Nat Med, 2016, 22(2): 183-93.
4	Inagi R, Ishimoto Y, Nangaku M. Proteostasis in endoplasmic reticulum: new mechanisms in kidney disease[J]. Nat Rev Nephrol, 2014, 10(7): 369-78.
5	Yan MJ, Tang CY, Ma ZW, et al. DNA damage response in nephrotoxic and ischemic kidney injury[J]. Toxicol Appl Pharmacol, 2016, 313: 104-8.
6	Malek M, Nematbakhsh M. Renal ischemia/reperfusion injury; from pathophysiology to treatment[J]. J Renal Inj Prev, 2015, 4(2): 20-7.
7	Fang R, Wang CG, Jiang QF, et al. NEMO-IKKβ are essential for IRF3 and NF-κB activation in the cGAS-STING pathway[J]. J Immunol, 2017, 199(9): 3222-33.
8	Fang R, Jiang QF, Guan YK, et al. Golgi apparatus-synthesized sulfated glycosaminoglycans mediate polymerization and activation of the cGAMP sensor STING[J]. Immunity, 2021, 54(5): 962-75.e8.
9	Ren P, Cao JL, Lin PL, et al. Molecular mechanism of luteolin regulating lipoxygenase pathway against oxygen-glucose deprivation/reperfusion injury in H9c2 cardiomyocytes based on molecular docking[J]. Zhongguo Zhong Yao Za Zhi, 2021, 46(21): 5665-73.
10	Bi R, Yang YL, Liao HW, et al. Porphyromonas gingivalis induces an inflammatory response via the cGAS-STING signaling pathway in a periodontitis mouse model[J]. Front Microbiol, 2023, 14: 1183415.
11	Pressly JD, Park F. DNA repair in ischemic acute kidney injury[J]. Am J Physiol Renal Physiol, 2017, 312(4): F551-5.
12	Hu HL, Zou C. Mesenchymal stem cells in renal ischemia-reperfusion injury: biological and therapeutic perspectives[J]. Curr Stem Cell Res Ther, 2017, 12(3): 183-7.
13	Inagi R. Endoplasmic reticulum stress in the kidney as a novel mediator of kidney injury[J]. Nephron Exp Nephrol, 2009, 112(1): e1-9.
14	Cao Q, Wang YP, Niu ZG, et al. Potentiating tissue-resident type 2 innate lymphoid cells by IL-33 to prevent renal ischemia-reperfusion injury[J]. J Am Soc Nephrol, 2018, 29(3): 961-76.
15	Havasi A, Borkan SC. Apoptosis and acute kidney injury[J]. Kidney Int, 2011, 80(1): 29-40.
16	Yang DH, Tang M, Zhang MM, et al. Downregulation of G protein-coupled receptor kinase 4 protects against kidney ischemia-reperfusion injury[J]. Kidney Int, 2023, 103(4): 719-34.
17	Li XR, Liao J, Su XJ, et al. Human urine-derived stem cells protect against renal ischemia/reperfusion injury in a rat model via exosomal miR-146a-5p which targets IRAK1 [J]. Theranostics, 2020, 10(21): 9561-78.
18	Wang J, Xiong MR, Fan Y, et al. Mecp2 protects kidney from ischemia-reperfusion injury through transcriptional repressing IL-6/STAT3 signaling[J]. Theranostics, 2022, 12(8): 3896-910.
19	van Timmeren MM, van den Heuvel MC, Bailly V, et al. Tubular kidney injury molecule-1 (KIM-1) in human renal disease[J]. J Pathol, 2007, 212(2): 209-17.
20	Gkirtzimanaki K, Kabrani E, Nikoleri D, et al. IFNα impairs autophagic degradation of mtDNA promoting autoreactivity of SLE monocytes in a STING-dependent fashion[J]. Cell Rep, 2018, 25(4): 921-33.e5.
21	Gao YP, Zhang NN, Zeng ZH, et al. LncRNA PCAT1 activates SOX2 and suppresses radioimmune responses via regulating cGAS/STING signalling in non-small cell lung cancer[J]. Clin Transl Med, 2022, 12(4): e792.
22	Li X, Liu YJ, Wang Y, et al. Epoxy triglyceride enhances intestinal permeability via caspase-1/NLRP3/GSDMD and cGAS-STING pathways in dextran sulfate sodium-induced colitis mice[J]. J Agric Food Chem, 2023, 71(10): 4371-81.
23	Wu JJ, Zhao L, Hu HG, et al. Agonists and inhibitors of the STING pathway: potential agents for immunotherapy[J]. Med Res Rev, 2020, 40(3): 1117-41.
24	Barber GN. STING: infection, inflammation and cancer[J]. Nat Rev Immunol, 2015, 15(12): 760-70.
25	Lu L, Zhou HM, Ni M, et al. Innate immune regulations and liver ischemia-reperfusion injury[J]. Transplantation, 2016, 100(12): 2601-10.
26	DeWolf SE, Kasimsetty SG, Hawkes AA, et al. DAMPs released from injured renal tubular epithelial cells activate innate immune signals in healthy renal tubular epithelial cells[J]. Transplantation, 2022, 106(8): 1589-99.
27	Raup-Konsavage WM, Wang YM, Wang WW, et al. Neutrophil peptidyl arginine deiminase-4 has a pivotal role in ischemia/reperfusion-induced acute kidney injury[J]. Kidney Int, 2018, 93(2): 365-74.
28	Salvadori M, Rosso G, Bertoni E. Update on ischemia-reperfusion injury in kidney transplantation: Pathogenesis and treatment[J]. World J Transplant, 2015, 5(2): 52-67.
29	Liu CH, Wang QD, Niu L. Sufentanil inhibits Pin1 to attenuate renal tubular epithelial cell ischemia-reperfusion injury by activating the PI3K/AKT/FOXO1 pathway[J]. Int Urol Nephrol, 2023, 55(8): 1903-16.
30	Wu B, Xu MM, Fan C, et al. STING inhibitor ameliorates LPS-induced ALI by preventing vascular endothelial cells-mediated immune cells chemotaxis and adhesion[J]. Acta Pharmacol Sin, 2022, 43(8): 2055-66.
31	Liu R, Li JY, Shao JC, et al. Innate immune response orchestrates phosphoribosyl pyrophosphate synthetases to support DNA repair[J]. Cell Metab, 2021, 33(10): 2076-89.e9.
32	Yang B, Li X, Fu Y, et al. MEK inhibition remodels the immune landscape of mutant KRAS tumors to overcome resistance to PARP and immune checkpoint inhibitors[J]. Cancer Res, 2021, 81(10): 2714-29.
33	Zhang YN, Dong YL, Hao WP, et al. Increased cGAS/STING signaling components in patients with Mooren's ulcer[J]. Int J Ophthalmol, 2021, 14(11): 1660-5.
34	Hong Z, Mei JH, Li CH, et al. STING inhibitors target the cyclic dinucleotide binding pocket[J]. Proc Natl Acad Sci U S A, 2021, 118(24): e2105465118.
35	Diao FF, Bai J, Jiang CL, et al. The papain-like protease of porcine reproductive and respiratory syndrome virus impedes STING translocation from the endoplasmic reticulum to the Golgi apparatus by deubiquitinating STIM1[J]. J Virol, 2023, 97(4): e0018823.
36	Yang BX, Xie XR, Wu ZY, et al. DNA damage-mediated cellular senescence promotes hand-foot syndrome that can be relieved by thymidine prodrug[J]. Genes Dis, 2022, 10(6): 2557-71.
37	Ablasser A, Chen ZJ. cGAS in action: expanding roles in immunity and inflammation[J]. Science, 2019, 363(6431): eaat8657.
38	Gulen MF, Koch U, Haag SM, et al. Signalling strength determines proapoptotic functions of STING[J]. Nat Commun, 2017, 8(1): 427.
39	Lehnardt S, Massillon L, Follett P, et al. Activation of innate immunity in the CNS triggers neurodegeneration through a Toll-like receptor 4-dependent pathway[J]. Proc Natl Acad Sci USA, 2003, 100(14): 8514-9.
40	Wang L, Yang JW, Lin LT, et al. Acupuncture attenuates inflammation in microglia of vascular dementia rats by inhibiting miR-93-mediated TLR4/MyD88/NF‑κB signaling pathway[J]. Oxid Med Cell Longev, 2020, 2020: 8253904.
41	Zhang NX, Guan C, Liu ZY, et al. Calycosin attenuates renal ischemia/reperfusion injury by suppressing NF‑κB mediated inflammation via PPARγ/EGR1 pathway[J]. Front Pharmacol, 2022, 13: 970616.
42	Alaaeldin R, Bakkar SM, Mohyeldin RH, et al. Azilsartan modulates HMGB1/NF-κB/p38/ERK1/2/JNK and apoptosis pathways during renal ischemia reperfusion injury[J]. Cells, 2023, 12(1): 185.
43	Ding HS, Huang Y, Qu JF, et al. Panaxynol ameliorates cardiac ischemia/reperfusion injury by suppressing NLRP3-induced pyroptosis and apoptosis via HMGB1/TLR4/NF-κB axis[J]. Int Immunopharmacol, 2023, 121: 110222.
44	Liu YY, Lei ZL, Chai H, et al. Salidroside alleviates hepatic ischemia-reperfusion injury during liver transplant in rat through regulating TLR-4/NF‑κB/NLRP3 inflammatory pathway[J]. Sci Rep, 2022, 12(1): 13973.
45	Li N, Zhou H, Wu HM, et al. STING-IRF3 contributes to lipopolysaccharide-induced cardiac dysfunction, inflammation, apoptosis and pyroptosis by activating NLRP3[J]. Redox Biol, 2019, 24: 101215.

[1]	Zhengyuan FAN, Zihan SHEN, Ya LI, Tingting SHEN, Gaofeng LI, Suyun LI. Protective effect of Bufei Yishen Formula against cigarette smoke extract-induced human bronchial epithelial cell damage and its mechanism [J]. Journal of Southern Medical University, 2025, 45(7): 1372-1379.
[2]	Haiyi ZHOU, Siyi HE, Ruifang HAN, Yongge GUAN, Lijuan DONG, Yang SONG. Moxibustion promotes endometrial repair in rats with thin endometrium by inhibiting the NLRP3/pyroptosis axis via upregulating miR-223-3p [J]. Journal of Southern Medical University, 2025, 45(7): 1380-1388.
[3]	Liming WANG, Hongrui CHEN, Yan DU, Peng ZHAO, Yujie WANG, Yange TIAN, Xinguang LIU, Jiansheng LI. Yiqi Zishen Formula ameliorates inflammation in mice with chronic obstructive pulmonary disease by inhibiting the PI3K/Akt/NF-κB signaling pathway [J]. Journal of Southern Medical University, 2025, 45(7): 1409-1422.
[4]	Xinheng WANG, Xiaohan SHAO, Tongtong LI, Lu ZHANG, Qinjun YANG, Weidong YE, Jiabing TONG, Zegeng LI, Xiangming FANG. Pingchuanning Formula suppresses airway inflammation in a rat model of asthmatic cold syndrome by regulating the HMGB1/Beclin-1 axis-mediated autophagy [J]. Journal of Southern Medical University, 2025, 45(6): 1153-1162.
[5]	Zhihua TIAN, Qingqing YANG, Xin CHEN, Fangfang ZHANG, Baimao ZHONG, Hong CAO. Spermine suppresses GBP5-mediated NLRP3 inflammasome activation in macrophages to relieve vital organ injuries in neonatal mice with enterovirus 71 infection [J]. Journal of Southern Medical University, 2025, 45(5): 901-910.
[6]	Anbang ZHANG, Xiuqi SUN, Bo PANG, Yuanhua WU, Jingyu SHI, Ning ZHANG, Tao YE. Electroacupuncture pretreatment alleviates cerebral ischemia-reperfusion injury in rats by inhibiting ferroptosis through the gut-brain axis and the Nrf2/HO-1 signaling pathway [J]. Journal of Southern Medical University, 2025, 45(5): 911-920.
[7]	Fenlan BIAN, Shiyao NI, Peng ZHAO, Maonanxing QI, Bi TANG, Hongju WANG, Pinfang KANG, Jinjun LIU. Asiaticoside alleviates myocardial ischemia-reperfusion injury in rats by inhibiting NLRP3 inflammasome-mediated pyroptosis [J]. Journal of Southern Medical University, 2025, 45(5): 977-985.
[8]	Xiaotao LIANG, Yifan XIONG, Xueqi LIU, Xiaoshan LIANG, Xiaoyu ZHU, Wei XIE. Huoxue Shufeng Granule alleviates central sensitization in chronic migraine mice via TLR4/NF-κB inflammatory pathway [J]. Journal of Southern Medical University, 2025, 45(5): 986-994.
[9]	Yalei SUN, Meng LUO, Changsheng GUO, Jing GAO, Kaiqi SU, Lidian CHEN, Xiaodong FENG. Amentoflavone alleviates acute lung injury in mice by inhibiting cell pyroptosis [J]. Journal of Southern Medical University, 2025, 45(4): 692-701.
[10]	Yang YANG, Kai WANG, Jianxiu LIU, Zhimo ZHOU, Wen JIA, Simou WU, Jinxing LI, Fang HE, Ruyue CHENG. Early life Bifidobacterium bifidum BD-1 intervention alleviates hyperactivity of juvenile female rats with attention deficit hyperactivity disorder [J]. Journal of Southern Medical University, 2025, 45(4): 702-710.
[11]	Zhengwang ZHU, Linlin WANG, Jinghan ZHAO, Ruixue MA, Yuchun YU, Qingchun CAI, Bing WANG, Pingsheng ZHU, Mingsan MIAO. Tuihuang Mixture improves α‑naphthylisothiocyanate-induced cholestasis in rats by inhibiting NLRP3 inflammasomes via regulating farnesoid X receptor [J]. Journal of Southern Medical University, 2025, 45(4): 718-724.
[12]	Yi ZHANG, Yu SHEN, Zhiqiang WAN, Song TAO, Yakui LIU, Shuanhu WANG. High expression of CDKN3 promotes migration and invasion of gastric cancer cells by regulating the p53/NF-κB signaling pathway and inhibiting cell apoptosis [J]. Journal of Southern Medical University, 2025, 45(4): 853-861.
[13]	Jinshui ZHANG, Shuo LI, Dongdong WEI, Xin CHENG, Yun DENG, Youzhi ZHANG. Protective effect of graphene heating film far-infrared hyperthermia against frostbite in mice [J]. Journal of Southern Medical University, 2025, 45(3): 522-530.
[14]	Mingyuan LI, Wei ZHANG, Mengqing HUA. Bardoxolone methyl alleviates acute liver injury in mice by inhibiting NLRP3 inflammasome activation [J]. Journal of Southern Medical University, 2024, 44(9): 1662-1669.
[15]	Yifan JIANG, Xiaorong LI, Jiayi GENG, Yongfeng CHEN, Bi TANG, Pinfang KANG. Quercetin ameliorates diabetic kidney injury in rats by inhibiting the HMGB1/RAGE/ NF-κB signaling pathway [J]. Journal of Southern Medical University, 2024, 44(9): 1769-1775.