High KHSRP expression promotes gastric adenocarcinoma metastasis: the mediating role of the JAK1/STAT3 signaling axis

doi:10.12122/j.issn.1673-4254.2024.09.16

Abstract

Abstract:

Objective To investigate the regulatory effect of KHSRP on progression of gastric adenocarcinoma and the role of the JAK1/STAT3 signaling axis in mediating its effect. Methods KHSRP mRNA expression level was detected using qRT-PCR in 120 pairs of gastric adenocarcinoma and adjacent tissues, 4 gastric adenocarcinoma cell lines (MKN-28, HGC-27, CRL-5822, and SNU-1) and normal human gastric mucosal GES-1 cells. In HGC-27 cells with KHSRP knockdown and SNU-1 cells with KHSRP overexpression, cell proliferation, migration, invasion and expression levels of JAK/STAT were evaluated using CCK-8 assay, Transwell migration and invasion assays, and Western blotting. In BALB/c-nude mice, HGC-27 cells with KHSRP knockdown and SNU-1 cells overexpressing KHSRP were injected either subcutaneous or via the tail vein to observe subcutaneous xenograft growth and lung metastasis of the tumor cells. Results Gastric adenocarcinoma tissues and cell lines all showed significantly increased KHSRP expression as compared with the adjacent tissues and GES-1 cells. In HGC-27 cells, KHSRP knockdown significantly inhibited cell proliferation, migration and invasion, while KHSRP overexpression enhanced the malignant behaviors of SNU-1 cells. In nude mice, inoculation of HGC-27 cells with KHSRP knockdown resulted in smaller tumor volume and weight, slower cell proliferation rate and fewer lung metastatic foci, and KHSRP-overexpressing SNU-1 cells produced the opposite results. KHSRP knockdown in HGC-27 cells significantly down-regulated the expression levels of JAK1 and STAT3, which were obviously increased in KHSRP-overexpressing SNU-1 cells. Conclusion High expressions of KHSRP promote progression and metastasis of gastric adenocarcinoma possibly by regulating the JAK1/STAT3 signaling axis.

Key words: STAD, molecular mechanism, JAK1, STAT3, KHSRP

Hui ZHANG, Yangyang LIU, Xiapeng LI, Mengyao WANG, Li LI, Haitao WEI. High KHSRP expression promotes gastric adenocarcinoma metastasis: the mediating role of the JAK1/STAT3 signaling axis[J]. Journal of Southern Medical University, 2024, 44(9): 1760-1768.

Figures/Tables 7

Tab.1 Sequences of the primers for RT-qPCR

Primer	Sequence (5'-3')
KHSRP mRNA-R	AATGAGTACGGATCTCGGATTGG
KHSRP mRNA-F	CCGTCATCTTGCTTGAACTGTA
GAPDH-R	5'-GAAGGTGAAGGTCGGAGTC-3
GAPDH-F	5'-GAAGATGGTGATGGGATTTC-3'
U6-R	5'-CGCTTCGGCACATATACTA-3'
U6-F	5'-CGCTTCACGAATTTGCGTGTCA-3'

Fig.1 KHSRP is highly expressed in gastric adenocarcinoma. A: Immunohistochemical staining of gastric adenocarcinoma and adjacent tissues. B: Western blotting for detecting KHSRP in gastric adenocarcinoma and adjacent tissues. C: KHSRP protein expression level in gastric adenocarcinoma and adjacent tissues. D: Correlation of expression levels of KHSRP with overall survival rate of the patients.

Fig.2 High KHSRP expression promotes proliferation, migration, and invasion of gastric adenocarcinoma cells. A: Transfection efficiency in MNK-28, HGC-27, CRL-5822, and SNU-1 cells assessed by RT-qPCR. B: Proliferation of the transfected cells assessed using CCK-8 assay. C: Transwell assay for assessing migration and invasion of the transfected cells. D: Statistical analysis of the results of Transwell assay. *P<0.05, **P<0.01.

Fig.3 High KHSRP expression promote growth, migration and invasion of gastric adenocarcinoma cells in nude mice. A-D: Dissected subcutaneous tumors from nude mice and quantitative analysis of tumor weight and volume. E, F: Dissected lung metastatic tumors of gastric adenocarcinoma and HE staining (Original magnification: ×200). G: Quantitative analysis of lung metastatic nodules of derived from different gastric adenocarcinoma cells after tail vein injection. *P<0.05, **P<0.01.

Fig.4 RT-qPCR for detecting mRNA expressions of JAK/STAT pathway-related proteins in HGC-27 cells with KHSRP knockdown (A) and SNU-1 cells with KHSRP overexpression (B). **P<0.01.

Fig.5 Western blotting for detecting expressions of JAK/STAT pathway-related proteins in HGC-27 cells with KHSRP knockdown and SNU-1 cells with KHSRP overexpression. A: Western blots of the proteins. B: Quantitative analysis of the protein expression levels. **P<0.01.

Fig.6 High expression of KHSRP promotes proliferation, migration and invasion of gastric adenocarcinoma cells by regulating JAK1, STAT3 signaling pathway. A, B: RT-qPCR for assessing transfection efficiency of HGC-27sh-JAK1 and HGC-27sh-STAT3 cells. C: CCK-8 assay of HGC-27 cells showed that KHSRP overexpression attenuated inhibitory effects of sh-JAK1 and sh-STAT3 on cell proliferation. D: Transwell assay showing that KHSRP overexpression promoted migration and invasion of HGC-27sh-JAK1 and HGC-27sh-STAT3 cells. *P<0.05 vs HGC-27sh-NC, **P<0.01 vs HGC-27sh-NC.

References 36

1	Joseph A, Raja S, Kamath S, et al. Esophageal adenocarcinoma: a dire need for early detection and treatment[J]. Cleve Clin J Med, 2022, 89(5): 269-79.
2	Chang JJ, Wu H, Wu J, et al. Constructing a novel mitochondrial-related gene signature for evaluating the tumor immune micro-environment and predicting survival in stomach adenocarcinoma[J]. J Transl Med, 2023, 21(1): 191.
3	Gallo A, Ronzio M, Bezzecchi E, et al. NF-Y subunits overexpression in gastric adenocarcinomas (STAD)[J]. Sci Rep, 2021, 11(1): 23764.
4	Zhang M, Hu SF, Min M, et al. Dissecting transcriptional heterogeneity in primary gastric adenocarcinoma by single cell RNA sequencing[J]. Gut, 2021, 70(3): 464-75.
5	Yang M, Sun XB, Chen YY, et al. Twenty cases of gastric adenocarcinoma of the fundic gland type[J]. Scand J Gastroenterol, 2023, 58(7): 744-50.
6	Stancu MI, Giubelan A, Mitroi G, et al. Assessment of tumor microenvironment in gastric adenocarcinoma[J]. Rom J Morphol Embryol, 2023, 64(2): 251-61.
7	Xu JY, Wang DS, Ma HL, et al. KHSRP combines transcriptional and posttranscriptional mechanisms to regulate monocytic differentiation[J]. Blood Sci, 2022, 4(3): 103-15.
8	Olguin SL, Patel P, Buchanan CN, et al. KHSRP loss increases neuronal growth and synaptic transmission and alters memory consolidation through RNA stabilization[J]. Commun Biol, 2022, 5(1): 672.
9	Zhao Y, Wen SM, Li H, et al. Enhancer RNA promotes resistance to radiotherapy in bone-metastatic prostate cancer by m6A modification[J]. Theranostics, 2023, 13(2): 596-610.
10	Paizula X, Wulaying A, Chen D, et al. KHSRP has oncogenic functions and regulates the expression and alternative splicing of DNA repair genes in breast cancer MDA-MB-231 cells[J]. Sci Rep, 2024, 14(1): 14694.
11	Sidali A, Teotia V, Solaiman NS, et al. AU-rich element RNA binding proteins: At the crossroads of post-transcriptional regulation and genome integrity[J]. Int J Mol Sci, 2021, 23(1): 96.
12	Yang YC, Lin YW, Lee WJ, et al. The RNA-binding protein KSRP aggravates malignant progression of clear cell renal cell carcinoma through transcriptional inhibition and post-transcriptional destabilization of the NEDD4L ubiquitin ligase[J]. J Biomed Sci, 2023, 30(1): 68.
13	Liu Z, Wang XY, Liu L, et al. Long non-coding RNA SLC7A11 antisense RNA1 promotes oral squamous cell carcinoma progression by regulating ubiquitination of K-homology type splicing regulatory protein[J]. Arch Oral Biol, 2023, 154: 105762.
14	Chen MM, Wang SL. Preclinical development and clinical studies of targeted JAK/STAT combined Anti-PD-1/PD-L1 therapy[J]. Int Immunopharmacol, 2024, 130: 111717.
15	Hu Q, Bian QH, Rong DC, et al. JAK/STAT pathway: Extracellular signals, diseases, immunity, and therapeutic regimens[J]. Front Bioeng Biotechnol, 2023, 11: 1110765.
16	Xue C, Yao QF, Gu XY, et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer[J]. Signal Transduct Target Ther, 2023, 8(1): 204.
17	Qin Z, Yue MT, Tang SJ, et al. EML4-ALK fusions drive lung adeno-to-squamous transition through JAK-STAT activation[J]. J Exp Med, 2024, 221(3): e20232028.
18	Hjazi A, Obaid RF, Ali SS, et al. The cross-talk between LncRNAs and JAK-STAT signaling pathway in cancer[J]. Pathol Res Pract, 2023, 248: 154657.
19	Hu XY, Li J, Fu MR, et al. The JAK/STAT signaling pathway: from bench to clinic[J]. Signal Transduct Target Ther, 2021, 6(1): 402.
20	López-Mejía JA, Mantilla-Ollarves JC, Rocha-Zavaleta L. Modulation of JAK-STAT signaling by LNK: a forgotten oncogenic pathway in hormone receptor-positive breast cancer[J]. Int J Mol Sci, 2023, 24(19): 14777.
21	Gravina AG, Pellegrino R, Esposito A, et al. The JAK-STAT pathway as a therapeutic strategy in cancer patients with immune checkpoint inhibitor-induced colitis: a narrative review[J]. Cancers, 2024, 16(3): 611.
22	Wang YH, Wang Z, Li SY, et al. Deciphering JAK/STAT signaling pathway: a multifaceted approach to tumorigenesis, progression and therapeutic interventions[J]. Int Immunopharmacol, 2024, 131: 111846.
23	Guo H, Zhang C, Tang XT, et al. HHLA2 activates the JAK/STAT signaling pathway by binding to TMIGD2 in hepatocellular carcinoma cells[J]. Inflammation, 2022, 45(4): 1585-99.
24	Wang L, Zhao DF, Wang H, et al. FPS-ZM1 inhibits LPS-induced microglial inflammation by suppressing JAK/STAT signaling pathway[J]. Int Immunopharmacol, 2021, 100: 108117.
25	Wang S, Xia D, Wang XZ, et al. C/EBPβ regulates the JAK/STAT signaling pathway in triple-negative breast cancer[J]. FEBS Open Bio, 2021, 11(4): 1250-8.
26	Sun YC, Gong WP, Zhang S. METTL3 promotes colorectal cancer progression through activating JAK1/STAT3 signaling pathway[J]. Cell Death Dis, 2023, 14(11): 765.
27	Cheng C, Cai YX, Liu XW, et al. KHSRP modulated cell proliferation and cell cycle via regulating PPP2CA and p27 expression in Wilms tumor[J]. Cell Signal, 2022, 100: 110447.
28	Yuan HH, Cai RJ, Chen BY, et al. Acetylated KHSRP impairs DNA-damage-response-related mRNA decay and facilitates prostate cancer tumorigenesis[J]. Mol Oncol, 2024 ：doi: 10.1002/1878-0261.13634. Online ahead of print.
29	Long F, Li L, Xie CB, et al. Intergenic CircRNA Circ_0007379 inhibits colorectal cancer progression by modulating miR-320a biogenesis in a KSRP-dependent manner[J]. Int J Biol Sci, 2023, 19(12): 3781-803.
30	Taniuchi K, Ogasawara M. Correction: KHSRP-bound small nucleolar RNAs associate with promotion of cell invasiveness and metastasis of pancreatic cancer[J]. Oncotarget, 2023, 14: 104.
31	Liu LF, Han L, Ma QZ, et al. Gastric adenocarcinoma of fundic gland (chief cell predominant type) coexisting with well differentiated intestinal adenocarcinoma: a case report[J]. Medicine, 2021, 100(21): e25861.
32	Park H, Lee S, Lee J, et al. Exploring the JAK/STAT signaling pathway in hepatocellular carcinoma: unraveling signaling complexity and therapeutic implications[J]. Int J Mol Sci, 2023, 24(18): 13764.
33	Zhang CN, Gu LQ, Xiao J, et al. Knockdown of RBM15 inhibits tumor progression and the JAK-STAT signaling pathway in cervical cancer[J]. BMC Cancer, 2023, 23(1): 684.
34	Zhu JF, Li Y, Lv X. IL4I1 enhances PD-L1 expression through JAK/STAT signaling pathway in lung adenocarcinoma[J]. Immuno-genetics, 2023, 75(1): 17-25.
35	Rusek M, Smith J, El-Khatib K, et al. The role of the JAK/STAT signaling pathway in the pathogenesis of Alzheimer's disease: new potential treatment target[J]. Int J Mol Sci, 2023, 24(1): 864.
36	Gao AH, Hu YR, Zhu WP. IFN-γ inhibits ovarian cancer progression via SOCS1/JAK/STAT signaling pathway[J]. Clin Transl Oncol, 2022, 24(1): 57-65.

[1]	HE Cheng, CHEN Wei, ZHANG Nianzhi, LUAN Jun, WANG Sanfeng, ZHANG You. Shenqi Chongcao Formula ameliorates inflammatory response in rats with pulmonary fibrosis by activating the ASS1/src/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2024, 44(4): 644-651.
[2]	XI Jin, ZHANG Min, ZHANG Yongyu, ZHANG Chen, ZHANG Yulu, WANG Rui, SHEN Lin, LI Jing, SONG Xue. Upregulating KLF11 ameliorates intestinal inflammation in mice with 2, 4, 6-trinitrobenesulfonic acid-induced colitis by inhibiting the JAK2/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2024, 44(4): 765-772.
[3]	ZHANG Feng, FAN Linlin, KANG Xia, WEI Haitao, LI Li. High LINC00626 expression promotes esophagogastric junction adenocarcinoma metastasis: the mediating role of the JAK1/STAT3/KHSRP axis [J]. Journal of Southern Medical University, 2024, 44(3): 541-552.
[4]	ZHAO Yuxi, ZHAO Xu, ZHU Qingnan, ZHU Bingrui, ZHANG Zhenbin, CHEN Jing. Therapeutic mechanism of Guizhi Gancao Decoction for heart failure: a network pharmacology-based analysis [J]. Journal of Southern Medical University, 2023, 43(5): 772-782.
[5]	ZHANG Mengying, LI Zhi, PEI Weiya, LI Xueqin, YANG Hui, ZHU Xiaolong, LÜ Kun. M2 macrophage-derived exosomal lncRNA NR_028113.1 promotes macrophage polarization possibly by activating the JAK2/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2023, 43(3): 393-399.
[6]	ZHAO Jialin, CHEN Ping, XU Guangli, SUN Jianhua, RUAN Yuanyuan, XUE Miaomiao, WU Yueliang. Bushen Huoxue Fang improves recurrent miscarriage in mice by down-regulating the JAK2/STAT3 pathway [J]. Journal of Southern Medical University, 2023, 43(2): 265-270.
[7]	FANG Yuxiao, WANG Shumei, YANG Qian, YOU Songfan, XING Xiangling. Chaihu Guizhi Decoction plus or minus formula combined with capecitabine inhibits IL-6/STAT3 signaling to suppress triple-negative breast cancer xenografts in nude mice [J]. Journal of Southern Medical University, 2022, 42(6): 905-912.
[8]	WANG Jie, LIU Jian, WEN Jianting, WANG Xin. Triptolide inhibits inflammatory response and migration of fibroblast like synovial cells in rheumatoid arthritis through the circRNA 0003353/JAK2/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2022, 42(3): 367-374.
[9]	. Use of Trichosanthis fructus and the core drug pair Trichosanthis fructus-Glycyrrhizae radix et rhizoma in traditional Chinese prescriptions: molecular mechanisms in network pharmacology and molecular docking [J]. Journal of Southern Medical University, 2021, 41(2): 173-183.
[10]	. Dihydromyricetin inhibits proliferation and migration of gastric cancer cells through regulating Akt/STAT3 signaling pathways and HMGB1 expression [J]. Journal of Southern Medical University, 2021, 41(1): 87-92.
[11]	. Electroacupuncture protects septic rats from acute lung injury through the JAK1/STAT3 pathway [J]. Journal of Southern Medical University, 2020, 40(11): 1662-1667.
[12]	. Long non-coding RNA LINC01106 regulates colorectal cancer cell proliferation and apoptosis through the STAT3 pathway [J]. Journal of Southern Medical University, 2020, 40(09): 1259-1264.
[13]	. Inverse ratio ventilation combined with PEEP in infants undergoing thoracoscopic surgery with one lung ventilation for lung cystadenomas: a randomized control trial of 63 cases [J]. Journal of Southern Medical University, 2020, 40(07): 1008-1012.
[14]	. Mechanism of Jiawei Huangqin decoction for treating ulcerative colitis in mice: the role of STAT3/NF-kB/IL-6 pathway [J]. Journal of Southern Medical University, 2020, 40(02): 196-202.
[15]	. Overexpression of leukemia inhibitory factor enhances chemotherapy tolerance of endometrial cancer cells in vitro [J]. Journal of Southern Medical University, 2020, 40(01): 20-26.