LncRNA MAGI2-AS3 enhances cisplatin sensitivity of non-small cell lung cancer cells by regulating the miR-1269a/PTEN/AKT pathway

doi:10.12122/j.issn.1673-4254.2024.10.22

Abstract

Abstract:

Objective To investigate the mechanism mediating the regulatory effect of lncRNA MAGI2-AS3 on cisplatin (DDP) resistance in non-small cell lung cancer (NSCLC). Methods MAGI2-AS3 and miR-1269a expression levels were detected by qRT-PCR in DDP-sensitive lung cancer cell lines (A549 and H1299) and their resistant counterparts (A549/DDP and H1299/DDP). In A549 and H1299 cells with MAGI2-AS3 silencing and A549/DDP and H1299/DDP cells overexpressing MAGI2-AS3, the effects of 20 μmol/L DDP on cell viability and apoptosis were examined with CCK-8 assay, colony formation assay, flow cytometry and Western blotting, and the changes in epithelial-mesenchymal transition (EMT) were assessed with wound healing and Transwell assays. The interaction between MAGI2-AS3, miR-1269a and PTEN was predicted using GEPIA, StarBase and miRDB and verified with luciferase reporter gene assay and radioimmunoprecipitation (RIP) assay. A miR-1269a mimic and pcDNA3.1-PTEN plasmid were used to perform the rescue assay. Results MAGI2-AS3 expression was significantly downregulated in lung cancer tissues (P<0.05) in association with a poor prognosis (P<0.05). In the two DDP-resistant lung cancer cell lines, MAGI2-AS3 expression was significantly lowered as compared with the sensitive cells. Silencing MAGI2-AS3 significantly enhanced cell viability and promoted EMT of A549 and H1299 cells irrespective of DDP treatment, and also decreased DDP-induced apoptosis of the cells. In A549/DDP and H1299/DDP cells, MAGI2-AS3 overexpression strongly repressed cell viability and EMT irrespective of DDP treatment and promoted DDP-induced cell apoptosis. Luciferase reporter gene and RIP assays confirmed the binding of MAGI2-AS3 with miR-1269a and the binding of miR-1269a with 3 '-UTR domain of PTEN. The rescue assay demonstrated that MAGI2-AS3 acted as a sponge for miR-1269a to promote PTEN expression and downregulate AKT phosphorylation, thus inhibiting EMT and promoting DDP-induced apoptosis of A549/DDP cells. Conclusion MAGI2-AS3 enhances DDP sensitivity of NSCLC by targeted regulation of the miR-1269a/PTEN/AKT signaling axis.

Key words: long noncoding RNA MAGI2-AS3, miR-1269a, non-small cell lung cancer, cisplatin resistance

Xirui FAN, Zhilin QI, Yuanjie DENG, Zihan YANG, Li SUN, Guohao LI, Juanjuan LIANG, Fei WU, Liwen YUAN. LncRNA MAGI2-AS3 enhances cisplatin sensitivity of non-small cell lung cancer cells by regulating the miR-1269a/PTEN/AKT pathway[J]. Journal of Southern Medical University, 2024, 44(10): 2033-2043.

Figures/Tables 6

Tab.1 Primer sequence for qRT-PCR

Primer	Forward primers	Reverse primers
MAGI2-AS3	ACTGGAAATACAAGCCCAAGT	TTTCCACTCTGCTGGTTATGG
GAPDH	AGTCCACTGGCGTCTTCA	GAGTCCTTCCACGATACCAA
U6	TTATGGGTCCTAGCCTGAC	CACTATTGCGGGTCTGC
miR-1269a	GACTGAGCCGTGCTACTGG	TGTCGTGGAGTCGGCAATTG
PTEN	GTCAGAGGCGCTATGTGTATTA	TTAGCTGGCAGACCACAA

Fig.1 Expression of MAGI2-AS3 in cisplatin-resistant NSCLC cell lines. A: qRT-PCR of MAGI2-AS3 in NSCLC cell lines A549, H1299, and HCC827 and in normal human lung epithelial cells (BEAS-2B). B: MAGI2-AS3 expression levels in LUAD tissues and normal adjacent tissues from the GEPIA database. C: Survival analysis of LUAD patients with high and low MAGI2-AS3 expressions. D, E: qRT-PCR of MAGI2-AS3 in cisplatin-sensitive A549 and H1299 cells and cisplatin-resistant A549/DDP and H1299/DDP cells. *P<0.05, **P<0.01, ***P<0.001.

Fig.2 MAGI2-AS3 overexpression enhances cisplatin sensitivity of non-small cell lung cancer cells. A, B, E, F: MAGI2-AS3 expressions in A549/DDP, A549, H1299/DDP and H1299 cells detected by qRT-PCR (**P<0.01, ***P<0.005 vs NC group). C, D, G, H: Viability of A549/DDP, A549, H1299/DDP and H1299 cells detected by CCK8 assay (#P<0.05, ###P<0.001 vs OE-NC group; &&&P<0.001 vs sh-NC group; **P<0.01, ***P<0.001). I, J: Viability of A549/DDP and A549 cells assessed by clone formation assay (#P<0.05 vs OE-NC group; &&&P<0.005 vs sh-NC group; **P<0.01, ***P<0.001). K, L: Apoptosis rates of A549/DDP, A549, H1299/DDP and H1299 cells detected by flow cytometry (###P<0.001 vs OE-NC group; &&&P<0.001 vs sh-NC group; **P<0.01, ***P<0.001). M-P: Western blotting for detecting Bax, Bcl-2, cleaved caspase3 protein expressions (**P<0.01, ***P<0.001 vs OE-NC group; ##P<0.01, ###P<0.001).

Fig.3 MAGI2-AS3 overexpression inhibits EMT progression of NSCLC cells. A-D: Migration ability of A549, A549/DDP, H1299, and H1299/DDP cells assessed by wound healing assay (Scale bar=100 μm). E-H: Quantitation of the results of wound healing assay (**P<0.01, ***P<0.001 vs NC group; ##P<0.01, ###P<0.001). I, J: Invasion ability of A549 and A549/DDP assessed by Transwell assay (Scale bar=100 μm; *P<0.05, **P<0.01, ***P<0.001 vs NC group; ##P<0.01). K-N: Western blotting for detecting N-cadherin, E-cadherin, and vimentin protein expressions (**P<0.01, ***P<0.001 vs OE-NC group; ###P<0.001).

Fig.4 MAGI2-AS3 enhances cisplatin sensitivity of A549/DDP cells by targeted adsorption of miR-1269a. A: qRT-PCR of MAGI2-AS3 expression in the nuclear and cytoplasmic fractions of A549/DDP cells. B: Schematic diagram showing the predicted wild-type and mutated binding sites for miR-1269a in MAGI2-AS3. C: qRT-PCR of miR-1269a expression in A549 and A549/DDP cells (**P<0.01). D: qRT-PCR of miR-1269a expression in A549/DDP and A549 cells with MAGI2-AS3 overexpression or knockdown (**P<0.01 vs OE-NC group; ##P<0.01 vs sh-NC group). E, F: qRT-PCR of MAGI2-AS3 and miR-1269a in A549/DDP cells treated with anti-AGO2 antibody in RIP assay (***P<0.001 vs IgG group). G: qRT-PCR of miR-1269a expression in A549/DDP cells transfected with the control mimic (NC) or miR-1269a mimic (**P<0.01). H: Luciferase activity of the reporter construct containing the wild-type or miR-1269a binding site mutant of MAGI2-AS3 (**P<0.01 vs mimic NC). I: qRT-PCR of miR-1269a in A549/DDP cells (**P<0.01). J: Transwell assay for assessing invasion ability of A549/DDP cells (Scale bar=100 μm; **P<0.01). K: Apoptosis rate of A549/DDP cells detected by flow cytometry (**P<0.01).

Fig.5 MAGI2-AS3 overexpression enhances cisplatin sensitivity of NSCLC cells by targeting the miR-1269a/PTEN/AKT pathway. A: Schematic diagram showing the predicted wild-type and mutated binding sites between PTEN mRNA sequence and miR-1269a sequence. B: Spearman correlation analysis of MAGI2-AS3 and PTEN expression levels in LUAD tissues.C: Luciferase activity of the reporter construct containing the wild-type or mutant 3′UTR sequence of PTEN (***P<0.001 vs mimic NC group). D, E: PTEN mRNA and protein expression levels in A549/DDP cells (***P<0.001). F: qRT-PCR for detecting PTEN mRNA expression (**P<0.01). G: Western blotting for detecting expression levels of PTEN, p-AKT, AKT, E-cadherin, N-cadherin, and cleaved caspase-3 in A549/DDP cells. H: Transwell assay for assessing A549/DDP cell invasion ability (Scale bar=100 μm; ***P<0.001). I: Apoptosis rate of A549/DDP cells detected by flow cytometry (**P<0.01, ***P<0.001).

References 25

1	Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-49.
2	Herbst RS, Morgensztern D, Boshoff C. The biology and management of non-small cell lung cancer[J]. Nature, 2018, 553(7689): 446-54.
3	Pan XF, Chen Y, Shen YZ, et al. Knockdown of TRIM65 inhibits autophagy and cisplatin resistance in A549/DDP cells by regulating miR-138-5p/ATG7[J]. Cell Death Dis, 2019, 10(6): 429.
4	Kryczka J, Kryczka J, Czarnecka-Chrebelska KH, et al. Molecular mechanisms of chemoresistance induced by cisplatin in NSCLC cancer therapy[J]. Int J Mol Sci, 2021, 22(16): 8885.
5	Lin J, Liao SS, Liu ZW, et al. LncRNA FGD5-AS1 accelerates cell proliferation in pancreatic cancer by regulating miR-520a-3p/KIAA1522 axis[J]. Cancer Biol Ther, 2021, 22(3): 257-66.
6	Peng Y, Tang DH, Zhao M, et al. Long non-coding RNA: a recently accentuated molecule in chemoresistance in cancer[J]. Cancer Metastasis Rev, 2020, 39(3): 825-35.
7	Zeng ZL, Zhao GF, Zhu HK, et al. LncRNA FOXD3-AS1 promoted chemo-resistance of NSCLC cells via directly acting on miR-127-3p/MDM2 axis[J]. Cancer Cell Int, 2020, 20: 350.
8	Tao XY, Li Y, Fan SQ, et al. Downregulation of Linc00173 increases BCL2 mRNA stability via the miR-1275/PROCA1/ZFP36L2 axis and induces acquired cisplatin resistance of lung adenocarcinoma[J]. J Exp Clin Cancer Res, 2023, 42(1): 12.
9	Jiao PF, Hou JN, Yao MY, et al. SNHG14 silencing suppresses the progression and promotes cisplatin sensitivity in non-small cell lung cancer[J]. Biomedecine Pharmacother, 2019, 117: 109164.
10	Liu KX, Cheng C, Li R, et al. Roles of lncRNA MAGI2-AS3 in human cancers[J]. Biomedecine Pharmacother, 2021, 141: 111812.
11	Yin Z, Ma TT, Yan JH, et al. LncRNA MAGI2-AS3 inhibits hepatocellular carcinoma cell proliferation and migration by targeting the miR-374b-5p/SMG1 signaling pathway[J]. J Cell Physiol, 2019, 234(10): 18825-36.
12	Yang G, Li T, Liu JY, et al. lncRNA MAGI2-AS3 suppresses castration-resistant prostate cancer proliferation and migration via the miR-106a-5p/RAB31 axis[J]. Genomics, 2023, 115(2): 110599.
13	Yang RW, Chen ZD, Ao S, et al. LncRNA MAGI2-AS3 inhibites tumor progression by up-regulating STAM via interacting with miR-142-3p in clear cell renal cell carcinoma[J]. Cell Signal, 2024, 113: 110954.
14	Luo J, Yao JF, Deng XF, et al. 14, 15-EET induces breast cancer cell EMT and cisplatin resistance by up-regulating integrin αvβ3 and activating FAK/PI3K/AKT signaling[J]. J Exp Clin Cancer Res, 2018, 37(1): 23.
15	Han ML, Zhao YF, Tan CH, et al. Cathepsin L upregulation-induced EMT phenotype is associated with the acquisition of cisplatin or paclitaxel resistance in A549 cells[J]. Acta Pharmacol Sin, 2016, 37(12): 1606-22.
16	Ashrafizadeh M, Zarrabi A, Hushmandi K, et al. Association of the epithelial-mesenchymal transition (EMT) with cisplatin resistance[J]. Int J Mol Sci, 2020, 21(11): 4002.
17	Wang F, Zu YW, Zhu SB, et al. Long noncoding RNA MAGI2-AS3 regulates CCDC19 expression by sponging miR-15b-5p and suppresses bladder cancer progression[J]. Biochem Biophys Res Commun, 2018, 507(1/2/3/4): 231-5.
18	Bu PC, Wang LH, Chen KY, et al. MiR-1269 promotes metastasis and forms a positive feedback loop with TGF-Β[J]. Nat Commun, 2015, 6: 6879.
19	Guo CX, Shi HM, Shang YL, et al. LncRNA LINC00261 overexpression suppresses the growth and metastasis of lung cancer via regulating miR-1269a/FOXO1 axis[J]. Cancer Cell Int, 2020, 20: 275.
20	Haddadi N, Lin YG, Travis G, et al. PTEN/PTENP1: 'Regulating the regulator of RTK-dependent PI3K/Akt signalling', new targets for cancer therapy[J]. Mol Cancer, 2018, 17(1): 37.
21	Worby CA, Dixon JE. PTEN[J]. Annu Rev Biochem, 2014, 83: 641-69.
22	张雨, 陆红玲, 徐刚. PI3K/AKT通路在非小细胞肺癌顺铂耐药中的作用[J]. 中国肺癌杂志, 2014, 17(8): 635-42.
23	Shi L, Zhu WL, Huang YY, et al. Cancer-associated fibroblast-derived exosomal microRNA-20a suppresses the PTEN/PI3K-AKT pathway to promote the progression and chemoresistance of non-small cell lung cancer[J]. Clin Transl Med, 2022, 12(7): e989.
24	Sun BT, Hu NJ, Cong D, et al. MicroRNA-25-3p promotes cisplatin resistance in Non-small-cell lung carcinoma (NSCLC) through adjusting PTEN/PI3K/AKT route[J]. Bioengineered, 2021, 12(1): 3219-28.
25	Xing SJ, Qu Y, Li CY, et al. Deregulation of lncRNA-AC078883.3 and microRNA-19a is involved in the development of chemoresistance to cisplatin via modulating signaling pathway of PTEN/AKT[J]. J Cell Physiol, 2019, 234(12): 22657-65.

[1]	Na ZHONG, Huijie WANG, Wenying ZHAO, Zhengui SUN, Biao GENG. High RNF7 expression enhances PD-1 resistance of non-small cell lung cancer cells by promoting CXCL1 expression and myeloid-derived suppressor cell recruitment via activating NF-κB signaling [J]. Journal of Southern Medical University, 2024, 44(9): 1704-1711.
[2]	Feifan LI, Junxin XIANG, Jiahui LIU, Xiaojing WANG, Hao JIANG. Overexpression of lncRNA FEZF1-AS1 promotes progression of non-small cell lung cancer via the miR-130a-5p/CCND1 axis [J]. Journal of Southern Medical University, 2024, 44(5): 841-850.
[3]	HAN Qiqi, YE Mengran, JIN Qili. Demethylzeylasteral inhibits proliferation, migration and invasion and promotes apoptosis of non-small cell lung cancer cells by inhibiting the AKT/CREB signaling pathway [J]. Journal of Southern Medical University, 2024, 44(2): 280-288.
[4]	Xuerou LIU, Yumei YANG, Wei LIU, Zhen ZHANG, Xingqi ZHOU, Wenyu XIE, Lin SHEN, Mengxiao ZHANG, Xian LI, Jialan ZANG, Shanshan LI. Euphorbia helioscopia inhibits proliferation, invasion, and migration and promotes apoptosis of non-small cell lung cancer cells [J]. Journal of Southern Medical University, 2024, 44(10): 1918-1925.
[5]	Yumei YANG, Xuerou LIU, Wei LIU, Xingqi ZHOU, Zhen ZHANG, Yan HU, Peipei LIU, Xian LI, Hao LIU, Shanshan LI. Aumolertinib combined with anlotinib inhibits proliferation of non-small cell lung cancer cells by down-regulating the PI3K/AKT pathway [J]. Journal of Southern Medical University, 2024, 44(10): 1965-1975.
[6]	XIE Ziping, LIU Liwei, FANG Jincun, ZHONG Xingyi, LIN Junhao, CHEN Fengsheng. ARHGAP21 inhibits epithelial-mesenchymal transition by inactivating the WNT signaling pathway in non-small cell lung cancer [J]. Journal of Southern Medical University, 2023, 43(8): 1322-1332.
[7]	LIU Fang, PENG Lanzhu, XI Jingle. High expression of MYH9 inhibits apoptosis of non-small cell lung cancer cells through activating the AKT/c-Myc pathway [J]. Journal of Southern Medical University, 2023, 43(4): 527-536.
[8]	NIU Wenwen, RONG Xiangyu, ZHAO Qian, LIU Xuerou, XU Liansong, LI Shanshan, LI Xian. Wine-processed Chuanxiong Rhizoma enhances efficacy of aumolertinib against EGFR-mutant non-small cell lung cancer xenografts in nude mouse brain [J]. Journal of Southern Medical University, 2023, 43(3): 375-382.
[9]	ZHAO Qilin, WANG Nan, LI Yaji, WU Qingchen, WU Lanxiang. Lnc-TMEM132D-AS1 overexpression reduces sensitivity of non-small cell lung cancer cells to osimertinib [J]. Journal of Southern Medical University, 2023, 43(2): 242-250.
[10]	KONG Dexian, SONG Liping, XIANG Yang. Construction of a prognostic nomogram combining PET/CT metabolic parameters and blood inflammatory markers for non-small cell lung cancer treated with first-line chemotherapy [J]. Journal of Southern Medical University, 2023, 43(12): 2139-2144.
[11]	WU Xiaofeng, ZHAN Riming, CHENG Dazhao, CHEN Li, WANG Tianyu, TANG Xudong. Exosomal FZD10 derived from non-small cell lung cancer cells promotes angiogenesis of human umbilical venous endothelial cells in vitro [J]. Journal of Southern Medical University, 2022, 42(9): 1351-1358.
[12]	. Expression of CDC25A in non-small cell lung cancer and its relationship with let-7 gene [J]. Journal of Southern Medical University, 2020, 40(11): 1622-1627.
[13]	. Spindle assembly checkpoint complex-related genes TTK and MAD2L1 are overexpressed in lung adenocarcinoma: a big data and bioinformatics analysis [J]. Journal of Southern Medical University, 2020, 40(10): 1422-1431.
[14]	. Gefitinib inhibits glycolysis and induces programmed cell death in non-small cell lung cancer cells [J]. Journal of Southern Medical University, 2020, 40(06): 884-892.
[15]	. Differential expression of miR-126-5p in lung adenocarcinoma and the possible mechanism [J]. Journal of Southern Medical University, 2019, 39(10): 1186-.