A two-site combined prediction model based on HOXA9 DNA methylation for early screening of risks of meningioma progression

doi:10.12122/j.issn.1673-4254.2024.11.07

Abstract

Abstract:

Objective To establish a recurrence risk prediction model for meningioma based on HOXA9 DNA methylation. Methods Meningioma-related datasets were downloaded from GEO database for screening homeobox genes (HOXs) with prognostic values using differential methylation and ROC curve analysis and Cox regression analysis. The differentially methylated CpG sites with high predictive efficacy were selected to establish the risk prediction model using Lasso-Cox regression analysis, based on which the patients were divided into high- and low-risk groups by the cutoff value. The methylation levels of CpG sites were verified at the cell and tissue levels using methylation-specific PCR (MS-PCR). Clinical meningioma tissue samples were used to validate the predictive efficacy of the model. Results HOXA9 methylation level was significantly up-regulated in meningiomas (P<0.001) and showed a high diagnostic efficiency (AUC=0.884) as an independent risk factor for overall survival (P<0.01) positively correlated with the degree of malignancy and poor prognosis of meningioma (P<0.05). Risk stratification by HOXA9 methylation was more accurate than WHO grading for predicting recurrence and patient survival time. The AUCs of the sites cg03217995 and cg21001184 were both above 0.8 for meningioma diagnosis and above 0.6 for predicting recurrence. The patients' clinical characteristics differed significantly between the high- and low-risk groups (P<0.001), and the prediction score of the model was an independent prognostic factor for meningioma (P<0.05). MS-PCR results showed that the methylation levels of the two sites increased significantly in meningioma cells. In clinical samples, the combined model showed a high prediction efficiency (AUC=0.857), and the predicted risk of progression was highly consistent with the patients' actual condition. Conclusion High HOXA9 methylation level is a predictor for poor prognosis of meningiomas, and the combined prediction model based on its CpG sites provides a new approach to early screening of meningioma patients at risk of progression.

Key words: meningioma, HOXA9, DNA methylation, CpG sites, diagnosis, prognosis

Ruxue TAN, Xiaozhang BAO, Liang HAN, Zhaohui LI, Nan TIAN. A two-site combined prediction model based on HOXA9 DNA methylation for early screening of risks of meningioma progression[J]. Journal of Southern Medical University, 2024, 44(11): 2110-2120.

Figures/Tables 7

Tab.1 Primer sequences for MS-PCR

Site	Primer sequence (5'-3')		Product length (bp)
cg03217995	M	F:TGGTGTTTTGTATAGGGGTATCG	95
	M	R:AACCCAATATTTCTCTTCCCCG	95
	U	F:AGGGTTTGGTGTTTTGTATAGGGGTATTG	107
	U	R:CTCCTAAACCCAAGATTTCTCTTCCCCA	107
cg21001184	M	F:GGTCGTGCGCGTTACGTGTTCGT	92
	M	R:AAATTATAACTACAAAACATCGA	92
	U	F:TTTATTGGTTGTGTGTGTTATGTGTTTGT	104
	U	R:CTATAAAAATTATAACTACAAAACATCAA	104

Fig.2 Correlation analysis of HOXA9 methylation and clinical characteristics of meningioma. A: Univariate Cox analysis and multivariate Cox analysis of HOXA9 methylation and clinical characteristics with overall survival (OS) of meningioma patients. B: HOXA9 methylation difference in meningioma patients with CDKN2A/B deletion and TRAF7/AKT1 mutation. C: Proportion of meningioma patients with NF2-SSV, NF2-CNV, Chr22q Loss, and Chr1q Amp in hypomethylation (Hypo) and hypermethylation (Hyper) groups and box plot of the differences in gene instability. D: Kaplan-Meier survival curves for recurrence-free survival (RFS) and OS in Hypo and Hyper groups. E: Alluvial chart of Choudhury classification and WHO grade in Hypo and Hyper groups. F: Box plots comparing activation of molecular signatures of proliferation between HOXA9 groups. G: Brier prediction analysis of RFS and OS in HOXA9 groups and WHO grade in meningiomas. *P<0.05, **P<0.01, ****P<0.0001.

Fig.3 Screening of CpG sites. A: Volcano map of differential methylation of CpG sites. B: The location of CpG sited. C: Heat map of CpG sites. D: Differential methylation between cg03217995 and cg21001184 in meningiomas and meningeal tissues. E: ROC analysis of cg03217995 and cg21001184. ****P<0.0001.

Fig.4 Construction of the two-site combined prediction model. A: Heat map of CpG sites arranged by risk score. The relationship between the risk scores and patients' clinic pathological characteristics was evaluated (a, Wilcoxon test; b, One-way ANOVA test). B: RFS and OS survival curves grouped by risk score.

Tab.2 Univariate and multivariate analysis of two CpG sites RFS modeling risk scores

Characteristics	Total (n)	Multi score	Univariate analysis		Multivariate analysis
Characteristics	Total (n)	Multi score	HR (95% CI)	P	HR (95% CI)	P
Risk score	243	1.341±0.422	3.654 (1.586-8.420)	0.002	2.725 (1.184-2.269)	0.018
WHO grade
1	212	1.317±0.416	4.391 (2.504-7.700)	<0.0001	3.203 (1.257-8.161)	0.015
2	29	1.505±0.450
3	2	1.548±0.222
RT
Yes	29	1.499±0.390	4.382 (2.071-9.072)	<0.0001	1.282 (0.380-2.322)	0.689
No	214	1.320±0.423	4.382 (2.071-9.072)	<0.0001	1.282 (0.380-2.322)	0.689
Age (year)
≤60	139	1.304±0.393	0.934 (0.484-1.802)	0.838
>60	104	1.390±0.456	0.934 (0.484-1.802)	0.838

Fig.5 Validation of the combined prediction model of the two sites. A: MS-PCR results of CpG sites cg03217995 and cg21001184 in meningioma cells and meningioma tissues. The density of each strip was quantified by imaging analysis, and the relative band density value was calculated as the ratio of methylation to methylation plus unmethylation (M/U+M). U: Unmethylated; M: Methylated; MM: molecular marker. B: ROC of CpG sites cg03217995 and cg21001184 for diagnosis of meningioma patients. C: Prediction of meningioma patients at CpG sites cg03217995 and cg21001184. P: Patient. ***P<0.001, ****P<0.0001.

Tab.3 Clinical information and experimental results of meningioma tissue samples

Case No.	WHO grade	Progression	β value		Risk score
Case No.	WHO grade	Progression	cg03217995	cg21001184	Risk score
1	1	no	0.389±0.018	0.233±0.022	0.708
2	1	no	0.428±0.016	0.445±0.008	1.008
3	1	yes (Invasion)	0.668±0.037	0.393±0.006	1.228
4	2	no	0.330±0.039	0.344±0.036	0.779
5	2	no	0.437±0.015	0.157±0.016	0.668
6	2	yes (Multiple recurrence)	0.588±0.019	0.639±0.029	1.420
7	3	no	0.492±0.034	0.169±0.011	0.741
8	3	no	0.696±0.016	0.393±0.008	1.238
9	3	no	0.614±0.024	0.731±0.013	1.561

References 31

1	Ostrom QT, Gittleman H, Truitt G, et al. CBTRUS statistical report: primary brain and other central nervous system tumors diagnosed in the United States in 2011-2015[J]. Neuro Oncol, 2018, 20(): iv1-86.
2	Louis DN, Perry A, Wesseling P, et al. The 2021 WHO Classification of Tumors of the Central Nervous System: a summary[J]. Neuro Oncol, 2021, 23(8): 1231-51.
3	Roehrkasse AM, Peterson JEG, Fung KM, et al. The discrepancy between standard histologic WHO grading of meningioma and molecular profile: a single institution series[J]. Front Oncol, 2022, 12: 846232.
4	Robert SM, Vetsa S, Nadar A, et al. The integrated multiomic diagnosis of sporadic meningiomas: a review of its clinical implications[J]. J Neurooncol, 2022, 156(2): 205-14.
5	Pellerino A, Bruno F, Palmiero R, et al. Clinical significance of molecular alterations and systemic therapy for meningiomas: where do we stand?[J]. Cancers, 2022, 14(9): 2256.
6	Maas SLN, Stichel D, Hielscher T, et al. Integrated molecular-morphologic meningioma classification: a multicenter retrospective analysis, retrospectively and prospectively validated[J]. J Clin Oncol, 2021, 39(34): 3839-52.
7	Nassiri F, Liu J, Patil V, et al. A clinically applicable integrative molecular classification of meningiomas[J]. Nature, 2021, 597(7874): 119-25.
8	Driver J, Hoffman SE, Tavakol S, et al. A molecularly integrated grade for meningioma[J]. Neuro Oncol, 2022, 24(5): 796-808.
9	Choudhury A, Magill ST, Eaton CD, et al. Meningioma DNA methylation groups identify biological drivers and therapeutic vulnerabilities[J]. Nat Genet, 2022, 54(5): 649-59.
10	Gehring WJ, Hiromi Y. Homeotic genes and the homeobox[J]. Annu Rev Genet, 1986, 20: 147-73.
11	Hu X, Wang Y, Zhang XY, et al. DNA methylation of HOX genes and its clinical implications in cancer[J]. Exp Mol Pathol, 2023, 134: 104871.
12	Di Vinci A, Brigati C, Casciano I, et al. HOXA7, 9, and 10 are methylation targets associated with aggressive behavior in meningiomas[J]. Transl Res, 2012, 160(5): 355-62.
13	Mamatjan Y, Voisin MR, Nassiri F, et al. Integrated molecular analysis reveals hypermethylation and overexpression of HOX genes to be poor prognosticators in isocitrate dehydrogenase mutant glioma[J]. Neuro Oncol, 2023, 25(11): 2028-41.
14	Ghisai SA, van Hijfte L, Vallentgoed WR, et al. Epigenetic landscape reorganization and reactivation of embryonic development genes are associated with malignancy in IDH-mutant astrocytoma[J]. bioRxiv, 2024: 2024.03.19.585212.
15	Kurscheid S, Bady P, Sciuscio D, et al. Chromosome 7 gain and DNA hypermethylation at the HOXA10 locus are associated with expression of a stem cell related HOX-signature in glioblastoma[J]. Genome Biol, 2015, 16(1): 16.
16	Schmitz RJ, Lewis ZA, Goll MG. DNA methylation: shared and divergent features across eukaryotes[J]. Trends Genet, 2019, 35(11): 818-27.
17	Constâncio V, Nunes SP, Henrique R, et al. DNA methylation-based testing in liquid biopsies as detection and prognostic biomarkers for the four major cancer types[J]. Cells, 2020, 9(3): 624.
18	Palanca-Ballester C, Rodriguez-Casanova A, Torres S, et al. Cancer epigenetic biomarkers in liquid biopsy for high incidence malignancies[J]. Cancers, 2021, 13(12): 3016.
19	Ibrahim J, Peeters M, van Camp G, et al. Methylation biomarkers for early cancer detection and diagnosis: current and future perspectives[J]. Eur J Cancer, 2023, 178: 91-113.
20	房明浩, 刘文励, 孟凡凯, 等. 白血病细胞HOX A基因亚群启动子区域异常甲基化的研究[J]. 中华血液学杂志, 2009, 30(7): 468-72.
21	Li SY, Wu HC, Mai HF, et al. Microarray-based analysis of whole-genome DNA methylation profiling in early detection of breast cancer[J]. J Cell Biochem, 2019, 120(1): 658-70.
22	Cheng WJ, Jiang Y, Liu CX, et al. Identification of aberrant promoter hypomethylation of HOXA10 in ovarian cancer[J]. J Cancer Res Clin Oncol, 2010, 136(8): 1221-7.
23	Na FF, Pan XY, Chen JY, et al. KMT2C deficiency promotes small cell lung cancer metastasis through DNMT3A-mediated epigenetic reprogramming[J]. Nat Cancer, 2022, 3(6): 753-67.
24	Lin ZH, Luo MZ, Chen XQ, et al. Combined detection of plasma ZIC1, HOXD10 and RUNX3 methylation is a promising strategy for early detection of gastric cancer and precancerous lesions[J]. J Cancer, 2017, 8(6): 1038-44.
25	Guo YL, Peng YJ, Gao D, et al. Silencing HOXD10 by promoter region hypermethylation activates ERK signaling in hepatocellular carcinoma[J]. Clin Epigenetics, 2017, 9: 116.
26	Han Y, Tu WW, Wen YG, et al. Identification and validation that up-expression of HOXA13 is a novel independent prognostic marker of a worse outcome in gastric cancer based on immunohistochemistry[J]. Med Oncol, 2013, 30(2): 564.
27	Wu YS, Jiang GL, Zhang N, et al. HOXA9, PCDH17, POU4F2, and ONECUT2 as a urinary biomarker combination for the detection of bladder cancer in Chinese patients with hematuria[J]. Eur Urol Focus, 2020, 6(2): 284-91.
28	Kim YJ, Yoon HY, Kim JS, et al. HOXA9, ISL1 and ALDH1A3 methylation patterns as prognostic markers for nonmuscle invasive bladder cancer: array-based DNA methylation and expression profiling[J]. Int J Cancer, 2013, 133(5): 1135-42.
29	Clark VE, Erson-Omay EZ, Serin A, et al. Genomic analysis of non-NF2 meningiomas reveals mutations in TRAF7, KLF4, AKT1, and SMO[J]. Science, 2013, 339(6123): 1077-80.
30	Sahin B, Katar S, Şahin SA, et al. Influence of human telomerase reverse transcriptase mutation on the aggressiveness and recurrence in meningiomas[J]. Cureus, 2021, 13(5): e15342.
31	彭怡琛, 郑义, 李生兰, 等. 高级别脑膜瘤中异常甲基化调控相关基因识别研究[J]. 首都医科大学学报, 2023, 44(5): 747-52.

[1]	Yingbo LI, Han BAO, Sen ZHANG, Jingxin MENG. Recent advances in responsive isolation, release and clinical application of circulating tumor cells [J]. Journal of Southern Medical University, 2024, 44(9): 1637-1644.
[2]	Xiaohua CHEN, Hui LU, Ziliang WANG, Lian WANG, Yongsheng XIA, Zhijun GENG, Xiaofeng ZHANG, Xue SONG, Yueyue WANG, Jing LI, Jianguo HU, Lugen ZUO. Role of Abelson interactor 2 in progression and prognosis of gastric cancer and its regulatory mechanisms [J]. Journal of Southern Medical University, 2024, 44(9): 1653-1661.
[3]	Mengnan YE, Hongmei WU, Yan MEI, Qingling ZHANG. High expression of CREM is associated with poor prognosis in gastric cancer patients [J]. Journal of Southern Medical University, 2024, 44(9): 1776-1782.
[4]	Kai JI, Guanyu YU, Leqi ZHOU, Tianshuai ZHANG, Qianlong LING, Wenjiang MAN, Bing ZHU, Wei ZHANG. HNRNPA1 gene is highly expressed in colorectal cancer: its prognostic implications and potential as a therapeutic target [J]. Journal of Southern Medical University, 2024, 44(9): 1685-1695.
[5]	Jingjing YANG, Lixia YIN, Ting DUAN, Minzhu NIU, Zhendong HE, Xinrui CHEN, Xiaofeng ZHANG, Jing LI, Zhijun GENG, Lugen ZUO. High expression of ATP5A1 in gastric carcinoma is correlated with a poor prognosis and enhanced glucose metabolism in tumor cells [J]. Journal of Southern Medical University, 2024, 44(5): 974-980.
[6]	SHEN Mengdi, ZHAO Na, DENG Xiaojing, DENG Min. High expression of COX6B2 in gastric cancer is associated with poor long-term prognosis and promotes cell proliferation and cell cycle progression by inhibiting p53 signaling [J]. Journal of Southern Medical University, 2024, 44(2): 289-297.
[7]	ZHANG Nuo, ZHANG Zhen, ZHANG Yulu, SONG Xue, ZHANG Xiaofeng, LI Jing, ZUO Lugen, HU Jianguo. PCID2 is highly expressed in gastric cancer and affects the prognosis by regulating cancer cell cycle and proliferation [J]. Journal of Southern Medical University, 2024, 44(2): 324-332.
[8]	ZHANG Wenjing, ZHANG Nuo, YANG Zi, ZHANG Xiaofeng, SUN Aofei, WANG Lian, SONG Xue, GENG Zhijun, LI Jing, HU Jianguo. Overexpression of BZW1 promotes invasion and metastasis of gastric cancer cells by regulating Wnt/β-catenin signaling and promoting epithelial-mesenchymal transition [J]. Journal of Southern Medical University, 2024, 44(2): 354-362.
[9]	DUAN Ting, ZHANG Zhen, SHI Jinran, XIAO Linyu, YANG Jingjing, YIN Lixia, ZHANG Xiaofeng, GENG Zhijun, LU Guoyu. High expression of CPNE3 correlates with poor long-term prognosis of gastric cancer by inhibiting cell apoptosis via activating PI3K/AKT signaling [J]. Journal of Southern Medical University, 2024, 44(1): 129-137.
[10]	YAO Yina, LIU Jia, ZHOU Xiangjun, LIU Zeyu, QIU Shizhen, HE Yingzheng, ZHOU Xueqiong. A pan-cancer analysis of TTC9A expression level and its correlation with prognosis and immune microenvironment [J]. Journal of Southern Medical University, 2024, 44(1): 70-82.
[11]	WANG Lian, XIA Yongsheng, ZHANG Zhen, LIU Xinyue, SHI Jinran, WANG Yueyue, LI Jing, ZHNAG Xiaofeng, GENG Zhijun, SONG Xue, ZUO Lugen. High expression of MRPL13 promotes cell cycle progression and proliferation of gastric cancer cells by inhibiting p53 signaling to affect long-term prognosis [J]. Journal of Southern Medical University, 2023, 43(9): 1558-1566.
[12]	ZUO Lugen, WANG Lian, YANG Zi, LI Junjie, WANG Wenfeng, LI Jing, WANG Yueyue, SONG Xue, ZHNAG Xiaofeng, GENG Zhijun. High expression of CAMSAP2 promotes invasion and metastasis of gastric cancer cells by upregulating TGF-β signaling [J]. Journal of Southern Medical University, 2023, 43(9): 1460-1468.
[13]	CAO Danping, CAI Juan, LI Yanna, DONG Runyu, WANG Zhixiong, ZUO Xueliang. TMEM64 is highly expressed in hepatocellular carcinoma and promotes tumor cell proliferation and invasion [J]. Journal of Southern Medical University, 2023, 43(8): 1345-1355.
[14]	WANG Qiusheng, ZHANG Zhen, WANG Lian, WANG Yu, YAO Xinyu, WANG Yueyue, ZHANG Xiaofeng, GE Sitang, ZUO Lugen. High expression of death-associated protein 5 promotes glucose metabolism in gastric cancer cells and correlates with poor survival outcomes [J]. Journal of Southern Medical University, 2023, 43(7): 1063-1070.
[15]	ZHANG Hao, ZHANG Zhen, WANG Qiusheng, WANG Lian, YANG Zi, GENG Zhijun, WANG Yueyue, LI Jing, ZUO Lugen. FJX1 overexpression is associated with poor prognosis and promotes gastric cancer proliferation via the PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2023, 43(6): 975-984.