Journal of Southern Medical University ›› 2026, Vol. 46 ›› Issue (8): 1799-1813.doi: 10.12122/j.issn.1673-4254.2026.08.08
Isolation, purification and immunomodulatory activity of polysaccharide from Lonicera caerulea L. var. edulis Turcz. ex Herder
Yangjia HUANG1(
), Xudong ZHANG2(), Qianru XIANG1,3, Hanquan GUO1, Shuang ZHENG1, Yuting HAO4, Wenzhen LIAO1()
- 1.Department of Nutrition and Food Hygiene, School of Public Health, Southern Medical University, Guangdong Key Laboratory of Tropical Disease Research, Guangzhou 510515, China
2.Shenzhen Pingshan District Center for Disease Control and Prevention, Shenzhen 518118, China
3.Department of Clinical Nutrition, Second Clinical Medical College, Zhujiang Hospital, Southern Medical University, Guangzhou 510280, China
4.Department of Infection Prevention and Control, Guangzhou Geriatric Hospital, Guangzhou 510030, China
-
Received:2026-01-23Online:2026-08-20Published:2026-08-01 -
Contact:Wenzhen LIAO E-mail:2398723665@qq.com;841528342@qq.com;wenzhenliao@163.com
Cite this article
Yangjia HUANG, Xudong ZHANG, Qianru XIANG, Hanquan GUO, Shuang ZHENG, Yuting HAO, Wenzhen LIAO. Isolation, purification and immunomodulatory activity of polysaccharide from Lonicera caerulea L. var. edulis Turcz. ex Herder[J]. Journal of Southern Medical University, 2026, 46(8): 1799-1813.
share this article
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.j-smu.com/EN/10.12122/j.issn.1673-4254.2026.08.08
Tab.1 Primer sequences for qRT-PCR of the target genes
| Gene | Primer sequence 5'-3' |
|---|---|
| GAPDH | F:AGGTCGGTGTGAACGGATTTG |
| R:GGGGTCGTTGATGGCAACA | |
| CD80 | F:TGCTGCTGATTCGTCTTTCAC |
| R:GAGGAGAGTTGTAACGGCAAG | |
| CD86 | F:TCAATGGGACTGCATATCTGCC |
| R:GCCAAAATACTACCAGCTCACT | |
| CD40 | F:GCAGTGTGTTACGTGCAGTG |
| R:TGTGCAGTGGCTTGTCAGTC | |
| IL-1β | F:GCAACTGTTCCTGAACTCAACT |
| R:ATCTTTTGGGGTCCGTCAACT | |
| IL-6 | F:TAGTCCTTCCTACCCCAATTTCC |
| R:TTGGTCCTTAGCCACTCCTTC | |
| TNF- α | F:CCCTCACACTCAGATCATCTTCT |
| R:GCTACGACGTGGGCTACAG | |
| iNOS | F:GTTCTCAGCCCAACAATACAAGA |
| R:GTGGACGGGTCGATGTCAC |
Tab.1 Primer sequences for qRT-PCR of the target genes
| Gene | Primer sequence 5'-3' |
|---|---|
| GAPDH | F:AGGTCGGTGTGAACGGATTTG |
| R:GGGGTCGTTGATGGCAACA | |
| CD80 | F:TGCTGCTGATTCGTCTTTCAC |
| R:GAGGAGAGTTGTAACGGCAAG | |
| CD86 | F:TCAATGGGACTGCATATCTGCC |
| R:GCCAAAATACTACCAGCTCACT | |
| CD40 | F:GCAGTGTGTTACGTGCAGTG |
| R:TGTGCAGTGGCTTGTCAGTC | |
| IL-1β | F:GCAACTGTTCCTGAACTCAACT |
| R:ATCTTTTGGGGTCCGTCAACT | |
| IL-6 | F:TAGTCCTTCCTACCCCAATTTCC |
| R:TTGGTCCTTAGCCACTCCTTC | |
| TNF- α | F:CCCTCACACTCAGATCATCTTCT |
| R:GCTACGACGTGGGCTACAG | |
| iNOS | F:GTTCTCAGCCCAACAATACAAGA |
| R:GTGGACGGGTCGATGTCAC |
Fig.1 Isolation and purification of crude polysaccharides from L. caerulea. A: Elution curve of THP by DEAE-sepharose-FF gel chromatography. B: Sephadex G-100 gel chromatography elution curve of THP-2. C: HPGPC results of THP-2. D: Standard curve of glucose. E: Standard curve of BCA protein.
Fig.1 Isolation and purification of crude polysaccharides from L. caerulea. A: Elution curve of THP by DEAE-sepharose-FF gel chromatography. B: Sephadex G-100 gel chromatography elution curve of THP-2. C: HPGPC results of THP-2. D: Standard curve of glucose. E: Standard curve of BCA protein.
Fig.2 Ion chromatogram of THP-2 trifluoroacetic acid hydrolysate.
Fig.2 Ion chromatogram of THP-2 trifluoroacetic acid hydrolysate.
Fig.3 Results of periodate oxidation and Smith degradation of THP-2. A: THP-2 sodium periodate concentration standard curve. B: Concentration change curve of sodium periodate in the reaction. C: Gas chromatography of Smith degradation products of THP-2 (a: ethylene glycol; b: glycerol; c: erythritol; d: arabinose; e: mannose; f: inositol; g: galactose).
Fig.3 Results of periodate oxidation and Smith degradation of THP-2. A: THP-2 sodium periodate concentration standard curve. B: Concentration change curve of sodium periodate in the reaction. C: Gas chromatography of Smith degradation products of THP-2 (a: ethylene glycol; b: glycerol; c: erythritol; d: arabinose; e: mannose; f: inositol; g: galactose).
Fig.4 Analysis of conformation, purity and functional group characteristics of THP-2. A: Congo red test results of THP-2. B: UV spectrum scan of crude polysaccharide. C: UV spectrum of THP-2. D: Infrared spectrum of THP-2.
Fig.4 Analysis of conformation, purity and functional group characteristics of THP-2. A: Congo red test results of THP-2. B: UV spectrum scan of crude polysaccharide. C: UV spectrum of THP-2. D: Infrared spectrum of THP-2.
Fig.5 One-dimensional 1H (A) and 13C NMR spectrum (B) of THP-2.
Fig.5 One-dimensional 1H (A) and 13C NMR spectrum (B) of THP-2.
Tab.2 Chemical shifts in 1H and ¹³C NMR spectra of THP-2 sugar residues
| Sugar residue | Chemical shift (ppm) | |||||
|---|---|---|---|---|---|---|
| C1/H1 | C2/H2 | C3/H3 | C4/H4 | C5/H5 | C6/H6 | |
| 5)-α-L-Alaf(1→ | 109.23/5.25 | 80.1/4.45 | 76.56/3.93 | 82.21/4.23 | -/- | -/- |
| 3)-α-L-Alaf(1→ | 107.49/5.16 | 76.56/- | 81.32/3.72 | 82.32/4.14 | 61.03/- | /- |
| 4)-β-D-Galp(1→ | 104.35/4.55 | 71.8/3.56 | 73.29/3.7 | 77.65/4.14 | /- | 60.73/3.73 |
| 3,4)-β-D-Xylp(1→ | 103.68/4.47 | 74.5/3.28 | 79.82/3.55 | 74.96/- | 63.28/- | 0/- |
| 6)-β-D-Glup(1→ | 103.4/4.52 | 71.8/3.55 | 76.56/3.31 | 69.85/3.54 | 75.13/3.66 | 69.47/3.83 |
| 4,6)-β-D-Glup(1→ | 103.13/4.5 | 73.38/3.31 | 76.56/- | 70.71/- | 72.96/- | 69.47/4.23 |
| 4)-β-D-Glup(1→ | 102.6/4.54 | 72.58/3.36 | 83.84/3.54 | 68.44/3.29 | -/3.31 | 61.26/3.83 |
| 4)-β-D-Manp(1→ | 101.63/4.66 | 71.46/4.05 | 72.74/3.72 | 77.65/3.73 | 76.56/3.49 | 61.26/3.83 |
| 4,6)-β-D-Manp(1→ | 100.13/4.63 | 70.71/3.95 | 71.8/3.7 | 76.71/3.71 | 73.72/3.66 | 66.85/3.85 |
| 6)-α-D-Glup(1→ | 99.36/5.12 | 72.18/3.95 | 74.5/4.05 | 69.85/3.85 | 70.71/3.93 | 66.85/- |
Tab.2 Chemical shifts in 1H and ¹³C NMR spectra of THP-2 sugar residues
| Sugar residue | Chemical shift (ppm) | |||||
|---|---|---|---|---|---|---|
| C1/H1 | C2/H2 | C3/H3 | C4/H4 | C5/H5 | C6/H6 | |
| 5)-α-L-Alaf(1→ | 109.23/5.25 | 80.1/4.45 | 76.56/3.93 | 82.21/4.23 | -/- | -/- |
| 3)-α-L-Alaf(1→ | 107.49/5.16 | 76.56/- | 81.32/3.72 | 82.32/4.14 | 61.03/- | /- |
| 4)-β-D-Galp(1→ | 104.35/4.55 | 71.8/3.56 | 73.29/3.7 | 77.65/4.14 | /- | 60.73/3.73 |
| 3,4)-β-D-Xylp(1→ | 103.68/4.47 | 74.5/3.28 | 79.82/3.55 | 74.96/- | 63.28/- | 0/- |
| 6)-β-D-Glup(1→ | 103.4/4.52 | 71.8/3.55 | 76.56/3.31 | 69.85/3.54 | 75.13/3.66 | 69.47/3.83 |
| 4,6)-β-D-Glup(1→ | 103.13/4.5 | 73.38/3.31 | 76.56/- | 70.71/- | 72.96/- | 69.47/4.23 |
| 4)-β-D-Glup(1→ | 102.6/4.54 | 72.58/3.36 | 83.84/3.54 | 68.44/3.29 | -/3.31 | 61.26/3.83 |
| 4)-β-D-Manp(1→ | 101.63/4.66 | 71.46/4.05 | 72.74/3.72 | 77.65/3.73 | 76.56/3.49 | 61.26/3.83 |
| 4,6)-β-D-Manp(1→ | 100.13/4.63 | 70.71/3.95 | 71.8/3.7 | 76.71/3.71 | 73.72/3.66 | 66.85/3.85 |
| 6)-α-D-Glup(1→ | 99.36/5.12 | 72.18/3.95 | 74.5/4.05 | 69.85/3.85 | 70.71/3.93 | 66.85/- |
Fig.6 Effect of THP-2 on proliferation of DC2.4 cells. **P<0.01.
Fig.6 Effect of THP-2 on proliferation of DC2.4 cells. **P<0.01.
Fig.7 Effects of THP-2 on expressions of the costimulatory molecules CD80 (A), CD40 (B), CD86 (C), MHC-II (D) and their MFI values in DC2.4 cells. *P<0.05, **P<0.01 vs THP-2 (0 μg/mL) + LPS (0 μg/mL).
Fig.7 Effects of THP-2 on expressions of the costimulatory molecules CD80 (A), CD40 (B), CD86 (C), MHC-II (D) and their MFI values in DC2.4 cells. *P<0.05, **P<0.01 vs THP-2 (0 μg/mL) + LPS (0 μg/mL).
Fig.7 Effects of THP-2 on expressions of the costimulatory molecules CD80 (A), CD40 (B), CD86 (C), MHC-II (D) and their MFI values in DC2.4 cells. *P<0.05, **P<0.01 vs THP-2 (0 μg/mL) + LPS (0 μg/mL).
Fig.7 Effects of THP-2 on expressions of the costimulatory molecules CD80 (A), CD40 (B), CD86 (C), MHC-II (D) and their MFI values in DC2.4 cells. *P<0.05, **P<0.01 vs THP-2 (0 μg/mL) + LPS (0 μg/mL).
Fig.8 qPCR and ELISA results of THP-2 on DC2.4 cells. A: Relative expression of CD80 mRNA. B: Relative expression of CD86 mRNA. C: Relative expression of CD40 mRNA. D: Relative expression of TNF-α mRNA. E: Relative expression of IL-1β mRNA. F: Relative expression of iNOS mRNA. G: Relative expression of IL-6 mRNA. H: IL-6 content in culture supernatant. I: Content of NO in the culture supernatant. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs THP-2 (0 μg/mL)+LPS (0 μg/mL).
Fig.8 qPCR and ELISA results of THP-2 on DC2.4 cells. A: Relative expression of CD80 mRNA. B: Relative expression of CD86 mRNA. C: Relative expression of CD40 mRNA. D: Relative expression of TNF-α mRNA. E: Relative expression of IL-1β mRNA. F: Relative expression of iNOS mRNA. G: Relative expression of IL-6 mRNA. H: IL-6 content in culture supernatant. I: Content of NO in the culture supernatant. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs THP-2 (0 μg/mL)+LPS (0 μg/mL).
Fig.9 Effect of THP-2 on proliferation of Raw264.7 cells. ***P<0.001, ****P<0.0001 vs THP-2 (0 μg/mL).
Fig.9 Effect of THP-2 on proliferation of Raw264.7 cells. ***P<0.001, ****P<0.0001 vs THP-2 (0 μg/mL).
Fig.10 qPCR and ELISA results of THP-2 on Raw264.7 cells. A: Relative expression of CD80 mRNA. B: Relative expression of CD86 mRNA. C: Relative expression of CD40 mRNA. D: Relative expression of TNF-α mRNA. E: Relative expression of IL-1β mRNA. F: Relative expression of iNOS mRNA. G: Content of TNF-α in culture supernatant. H: Content of IL-6 in culture supernatant. I: Content of NO in the culture supernatant. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs THP-2 (0 μg/mL)+LPS (0 μg/mL).
Fig.10 qPCR and ELISA results of THP-2 on Raw264.7 cells. A: Relative expression of CD80 mRNA. B: Relative expression of CD86 mRNA. C: Relative expression of CD40 mRNA. D: Relative expression of TNF-α mRNA. E: Relative expression of IL-1β mRNA. F: Relative expression of iNOS mRNA. G: Content of TNF-α in culture supernatant. H: Content of IL-6 in culture supernatant. I: Content of NO in the culture supernatant. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs THP-2 (0 μg/mL)+LPS (0 μg/mL).
Fig.11 Effect of THP-2 on p-p65, p-lκB, and p-Akt protein expressions in DC2.4 cells and p-IκB and p-p65 protein expressions in Raw264.7 cells. A: Content of p-p65 protein in DC2.4 cells. B: Content of p-IκB protein in DC2.4 cells. C: Content of p-Akt protein in DC2.4 cells. D: Content of p-IκB protein in Raw264.7 cells. E: Content of p-p65 protein in Raw264.7 cells. *P<0.05, **P<0.01, ****P<0.0001 vs THP-2 (0 μg/mL)+LPS (0 μg/mL).
Fig.11 Effect of THP-2 on p-p65, p-lκB, and p-Akt protein expressions in DC2.4 cells and p-IκB and p-p65 protein expressions in Raw264.7 cells. A: Content of p-p65 protein in DC2.4 cells. B: Content of p-IκB protein in DC2.4 cells. C: Content of p-Akt protein in DC2.4 cells. D: Content of p-IκB protein in Raw264.7 cells. E: Content of p-p65 protein in Raw264.7 cells. *P<0.05, **P<0.01, ****P<0.0001 vs THP-2 (0 μg/mL)+LPS (0 μg/mL).
| [1] | Schepetkin IA, Quinn MT. Botanical polysaccharides: Macrophage immunomodulation and therapeutic potential[J]. Int Immunopharmacol, 2006, 6(3): 317-33. doi：10.1016/j.intimp.2005.10.005 |
| [2] | Yin M, Zhang Y, Li H. Advances in research on immunoregulation of macrophages by plant polysaccharides[J]. Front Immunol, 2019, 10: 145. doi：10.3389/fimmu.2019.00145 |
| [3] | 黎美枫, 焦峪坤, 刘红菊, 等. 红花夹竹桃中提取的多糖具有较好的免疫调节活性[J]. 广东医科大学学报, 2025, 43(5): 506-14. |
| [4] | Wang DX, Li H, Li B, et al. Systematic fractionation and immunoenhancement of water-soluble polysaccharides isolated from fruit of Morus alba L[J]. Int J Biol Macromol, 2018, 116: 1056-63. doi：10.1016/j.ijbiomac.2018.05.106 |
| [5] | Zhao ZH, Dai H, Wu XM, et al. Characterization of a pectic polysaccharide from the fruit of Ziziphus jujuba [J]. Chem Nat Comp, 2007, 43(4): 374-6. doi：10.1007/s10600-007-0141-y |
| [6] | Senica M, Bavec M, Stampar F, et al. Blue honeysuckle (Lonicera caerulea subsp. edulis (Turcz. ex Herder) Hultén.) berries and changes in their ingredients across different locations[J]. J Sci Food Agric, 2018, 98(9): 3333-42. doi：10.1002/jsfa.8837 |
| [7] | Gołba M, Sokół-Łętowska A, Kucharska AZ. Health properties and composition of honeysuckle berry Lonicera caerulea L. an update on recent studies[J]. Molecules, 2020, 25(3): 749. doi：10.3390/molecules25030749 |
| [8] | Wang YH, Li B, Ma Y, et al. Lonicera caerulea berry extract attenuates lipopolysaccharide induced inflammation in BRL-3A cells: Oxidative stress, energy metabolism, hepatic function[J]. J Funct Foods, 2016, 24: 1-10. doi：10.1016/j.jff.2016.03.023 |
| [9] | Zhang CP, Li WH, Liu JR, et al. The effective analysis for blue honeysuckle extract in the treatment of hepatocellular carcinoma[J]. Evid Based Complement Altern Med, 2022, 2022: 9601020. doi：10.1155/2022/9601020 |
| [10] | Park M, Yoo JH, Lee YS, et al. Lonicera caerulea extract attenuates non-alcoholic fatty liver disease in free fatty acid-induced HepG2 hepatocytes and in high fat diet-fed mice[J]. Nutrients, 2019, 11(3): 494. doi：10.3390/nu11030494 |
| [11] | Raudsepp P, Anton D, Roasto M, et al. The antioxidative and antimicrobial properties of the blue honeysuckle (Lonicera caerulea L.), Siberian rhubarb (Rheum rhaponticum L.) and some other plants, compared to ascorbic acid and sodium nitrite[J]. Food Control, 2013, 31(1): 129-35. doi：10.1016/j.foodcont.2012.10.007 |
| [12] | Ma CL, Bai JW, Shao CT, et al. Degradation of blue honeysuckle polysaccharides, structural characteristics and antiglycation and hypoglycemic activities of degraded products[J]. Food Res Int, 2021, 143: 110281. doi：10.1016/j.foodres.2021.110281 |
| [13] | Pei FY, Cao XB, Wang XM, et al. Structural characteristics and bioactivities of polysaccharides from blue honeysuckle after probiotic fermentation[J]. LWT, 2022, 165: 113764. doi：10.1016/j.lwt.2022.113764 |
| [14] | Baumgart DC, Metzke D, Guckelberger O, et al. Aberrant plasmacytoid dendritic cell distribution and function in patients with Crohn’s disease and ulcerative colitis[J]. Clin Exp Immunol, 2011, 166(1): 46-54. doi：10.1111/j.1365-2249.2011.04439.x |
| [15] | Upham JW, Zhang GC, Rate A, et al. Plasmacytoid dendritic cells during infancy are inversely associated with childhood respiratory tract infections and wheezing[J]. J Allergy Clin Immunol, 2009, 124(4): 707-13.e2. doi：10.1016/j.jaci.2009.07.009 |
| [16] | Gerhard GM, Bill R, Messemaker M, et al. Tumor-infiltrating dendritic cell states are conserved across solid human cancers[J]. J Exp Med, 2021, 218(1): e20200264. doi：10.1084/jem.20200264 |
| [17] | Roberts EW, Broz ML, Binnewies M, et al. Critical role for CD103+/CD141+ dendritic cells bearing CCR7 for tumor antigen trafficking and priming of T cell immunity in melanoma[J]. Cancer Cell, 2016, 30(2): 324-36. doi：10.1016/j.ccell.2016.06.003 |
| [18] | Belgiovine C, D'Incalci M, Allavena P, et al. Tumor-associated macrophages and anti-tumor therapies: complex links[J]. Cell Mol Life Sci, 2016, 73(13): 2411-24. doi：10.1007/s00018-016-2166-5 |
| [19] | Chittezhath M, Dhillon MK, Lim JY, et al. Molecular profiling reveals a tumor-promoting phenotype of monocytes and macrophages in human cancer progression[J]. Immunity, 2014, 41(5): 815-29. doi：10.1016/j.immuni.2014.09.014 |
| [20] | Ganguly D, Haak S, Sisirak V, et al. The role of dendritic cells in autoimmunity[J]. Nat Rev Immunol, 2013, 13(8): 566-77. doi：10.1038/nri3477 |
| [21] | Vitali C, Mingozzi F, Broggi A, et al. Migratory, and not lymphoid-resident, dendritic cells maintain peripheral self-tolerance and prevent autoimmunity via induction of iTreg cells[J]. Blood, 2012, 120(6): 1237-45. doi：10.1182/blood-2011-09-379776 |
| [22] | Jiang ZL, Jiang JX, Zhang GX. Macrophages: a double-edged sword in experimental autoimmune encephalomyelitis[J]. Immunol Lett, 2014, 160(1): 17-22. doi：10.1016/j.imlet.2014.03.006 |
| [23] | Wynn TA, Chawla A, Pollard JW. Macrophage biology in development, homeostasis and disease[J]. Nature, 2013, 496(7446): 445-55. doi：10.1038/nature12034 |
| [24] | Wucherpfennig KW. Mechanisms for the induction of autoimmunity by infectious agents[J]. J Clin Invest, 2001, 108(8): 1097-104. doi：10.1172/jci200114235 |
| [25] | Wiercigroch E, Szafraniec E, Czamara K, et al. Raman and infrared spectroscopy of carbohydrates: a review[J]. Spectrochim Acta Part A Mol Biomol Spectrosc, 2017, 185: 317-35. doi：10.1016/j.saa.2017.05.045 |
| [26] | 张猛猛. 玛咖根部多糖的结构鉴定及免疫调节活性的研究[D]. 广州: 华南理工大学, 2019. |
| [27] | Yao HYY, Wang JQ, Yin JY, et al. A review of NMR analysis in polysaccharide structure and conformation: Progress, challenge and perspective[J]. Food Res Int, 2021, 143: 110290. doi：10.1016/j.foodres.2021.110290 |
| [28] | Hannuksela T, Hervé du Penhoat C. NMR structural determination of dissolved O-acetylated galactoglucomannan isolated from spruce thermomechanical pulp[J]. Carbohydr Res, 2004, 339(2): 301-12. doi：10.1016/j.carres.2003.10.025 |
| [29] | Yuan YF, Wang YB, Jiang YM, et al. Structure identification of a polysaccharide purified from Lycium barbarium fruit[J]. Int J Biol Macromol, 2016, 82: 696-701. doi：10.1016/j.ijbiomac.2015.10.069 |
| [30] | Zhao T, Mao GH, Feng WW, et al. Isolation, characterization and antioxidant activity of polysaccharide from Schisandra sphenanthera [J]. Carbohydr Polym, 2014, 105: 26-33. doi：10.1016/j.carbpol.2014.01.059 |
| [31] | Huang LL, Zhao J, Wei YL, et al. Structural characterization and mechanisms of macrophage immunomodulatory activity of a pectic polysaccharide from Cucurbita moschata Duch[J]. Carbohydr Polym, 2021, 269: 118288. doi：10.1016/j.carbpol.2021.118288 |
| [32] | He WW, Li ZP. Deciphering immunoregulatory mechanisms and structure-guided biosynthesis of β-glucans[J]. Carbohydr Polym, 2025, 368(Pt 2): 124254. doi：10.1016/j.carbpol.2025.124254 |
| [33] | Brown GD, Gordon S. A new receptor for β-glucans[J]. Nature, 2001, 413(6851): 36-7. doi：10.1038/35092620 |
| [34] | Liu YF, Zhang JS, Tang QJ, et al. Physicochemical characterization of a high molecular weight bioactive β-d-glucan from the fruiting bodies of Ganoderma lucidum [J]. Carbohydr Polym, 2014, 101: 968-74. doi：10.1016/j.carbpol.2013.10.024 |
| [35] | Martinez-Pomares L, Gordon S. Antigen presentation the macrophage way[J]. Cell, 2007, 131(4): 641-3. doi：10.1016/j.cell.2007.10.046 |
| [36] | Shapouri-Moghaddam A, Mohammadian S, Vazini H, et al. Macrophage plasticity, polarization, and function in health and disease[J]. J Cell Physiol, 2018, 233(9): 6425-40. doi：10.1002/jcp.26429 |
| [37] | Mantovani A, Biswas SK, Galdiero MR, et al. Macrophage plasticity and polarization in tissue repair and remodelling[J]. J Pathol, 2013, 229(2): 176-85. doi：10.1002/path.4133 |
| [38] | Kloc M, Ghobrial RM, Wosik J, et al. Macrophage functions in wound healing[J]. J Tissue Eng Regen Med, 2018: term.2772. doi：10.1002/term.2772 |
| [39] | He TP, Tang CK, Xu SL, et al. Interferon gamma stimulates cellular maturation of dendritic cell line DC2.4 leading to induction of efficient cytotoxic T cell responses and antitumor immunity[J]. Cell Mol Immunol, 2007, 4(2): 105-11. |
| [40] | Khatua S, Simal-Gandara J, Acharya K. Understanding immune-modulatory efficacy in vitro [J]. Chem Biol Interact, 2022, 352: 109776. doi：10.1016/j.cbi.2021.109776 |
| [41] | Kong LB, Smith W, Hao DJ. Overview of RAW264.7 for osteoclastogensis study: Phenotype and stimuli[J]. J Cell Mol Med, 2019, 23(5): 3077-87. doi：10.1111/jcmm.14277 |
| [42] | Weber A, Wasiliew P, Kracht M. Interleukin-1β (IL-1β) processing pathway[J]. Sci Signal, 2010, 3(105): e3105cm2. doi：10.1126/scisignal.3105cm2 |
| [43] | Tanaka T, Narazaki M, Kishimoto T. IL-6 in inflammation, immunity, and disease[J]. Cold Spring Harb Perspect Biol, 2014, 6(10): a016295. doi：10.1101/cshperspect.a016295 |
| [44] | Robbins RA, Grisham MB. Nitric oxide[J]. Int J Biochem Cell Biol, 1997, 29(6): 857-60. doi：10.1016/s1357-2725(96)00167-7 |
| [45] | Cinelli MA, Do HT, Miley GP, et al. Inducible nitric oxide synthase: Regulation, structure, and inhibition[J]. Med Res Rev, 2020, 40(1): 158-89. doi：10.1002/med.21599 |
| [46] | Hou GQ, Guo C, Song GH, et al. Lipopolysaccharide (LPS) promotes osteoclast differentiation and activation by enhancing the MAPK pathway and COX-2 expression in RAW264.7 cells[J]. Int J Mol Med, 2013, 32(2): 503-10. doi：10.3892/ijmm.2013.1406 |
| [47] | Lutz MB, Kukutsch NA, Menges M, et al. Culture of bone marrow cells in GM-CSF plus high doses of lipopolysaccharide generates exclusively immature dendritic cells which induce alloantigen- specific CD4 T cell anergy in vitro [J]. Eur J Immunol, 2000, 30(4): 1048-52. doi：10.1002/(sici)1521-4141(200004)30:4<1048::aid-immu1048>3.0.co;2-w |
| [48] | Rainer H, Goretzki A, Lin YJ, et al. Characterization of the immune-modulating properties of different β-glucans on myeloid dendritic cells[J]. Int J Mol Sci, 2024, 25(18): 9914. doi：10.3390/ijms25189914 |
| [49] | Ding J, Ning YL, Bai Y, et al. β‑Glucan induces autophagy in dendritic cells and influences T-cell differentiation[J]. Med Microbiol Immunol, 2019, 208(1): 39-48. doi：10.1007/s00430-018-0556-z |
| [50] | Horneck Johnston CJH, Ledwith AE, Lundahl MLE, et al. Recognition of yeast β‑glucan particles triggers immunometabolic signaling required for trained immunity[J]. iScience, 2024, 27(3): 109030. doi：10.1016/j.isci.2024.109030 |
| [51] | Chen JZ, Gu WY, Zhao KN. The role of PI3K/Akt pathway in β‑glucan-induced dendritic cell maturation[J]. Int Immuno-pharmacol, 2011, 11(4): 529. doi：10.1016/j.intimp.2011.01.027 |
| [52] | Miao Y, Jiang M, Qi L, et al. BCAP regulates dendritic cell maturation through the dual-regulation of NF-kappaB and PI3K/AKT signaling during infection[J]. Front Immunol. 2020, 11: 250. doi：10.3389/fimmu.2020.00250 |
| [53] | Zhang Y, Wang X, Yang H, et al. Kinase AKT controls innate immune cell development and function[J]. Immunology, 2013, 140(2): 143-52. doi：10.1111/imm.12123 |
| [54] | Vergadi E, Ieronymaki E, et al. Akt signaling pathway in macrophage activation and M1/M2 polarization[J]. J Immunol, 2017, 198(3): 1006-14. doi：10.4049/jimmunol.1601515 |
| [55] | Zhao SJ, Kong FQ, Jie J, et al. Macrophage MSR1 promotes BMSC osteogenic differentiation and M2-like polarization by activating PI3K/AKT/GSK3beta/beta-catenin pathway[J]. Theranostics. 2020, 10(1): 17-35. doi：10.7150/thno.36930 |
| [56] | Hayden MS, Ghosh S. NF‑κB in immunobiology[J]. Cell Res, 2011, 21(2): 223-44. doi：10.1038/cr.2011.13 |
| [57] | Shin MS, Park SB, Shin KS. Molecular mechanisms of immunomodulatory activity by polysaccharide isolated from the peels of Citrus unshiu [J]. Int J Biol Macromol, 2018, 112: 576-83. doi：10.1016/j.ijbiomac.2018.02.006 |
| [58] | Luo B, Dong LM, Xu QL, et al. Characterization and immunological activity of polysaccharides from Ixeris polycephala [J]. Int J Biol Macromol, 2018, 113: 804-12. doi：10.1016/j.ijbiomac.2018.02.165 |
| [59] | Kouakou K, Schepetkin IA, Yapi A, et al. Immunomodulatory activity of polysaccharides isolated from Alchornea cordifolia [J]. J Ethnopharmacol, 2013, 146(1): 232-42. doi：10.1016/j.jep.2012.12.037 |
| [1] | Yue ZHANG, Yuting DUAN, Chen ZHANG, Luzhe YU, Yingying LIU, Lihua XING, Lei WANG, Nianjun YU, Daiyin PENG, Weidong CHEN, Yanyan WANG. Poria cocos polysaccharide alleviates cyclophosphamide-induced intestinal barrier dysfunction and inflammation in mice by modulating gut flora [J]. Journal of Southern Medical University, 2026, 46(1): 34-46. |
| [2] | Zhengtao GAO, Pingyan LIN, Bingcan ZHOU, Mingheng CHEN, Erqi LIU, Tianxiang LEI, Huixin NI, Haixin LIU, Yao LIN, Qian XU. Hypericin ameliorates stress-induced depressive-like behaviors in mice by modulating the CN-NFAT calcium signaling pathway in microglia [J]. Journal of Southern Medical University, 2025, 45(3): 506-513. |
| [3] | Changlong FU, Ruolan CHEN, Shiqi XU, Jinxin YOU, Qing LIN, Yanfeng HUANG. Morinda officinalis polysaccharide delays osteoarthritis mouse chondrocyte degeneration by modulating the glycolysis-pyroptosis axis via targeting the lncRNA XIST [J]. Journal of Southern Medical University, 2025, 45(12): 2541-2550. |
| [4] | Liuqing LIU, Kun WANG, Xueqing WANG, Bingxin DU. Lycium barbarum polysaccharides alleviates cisplatin-induced granulosa cell injury by downregulating miR-23a [J]. Journal of Southern Medical University, 2025, 45(11): 2340-2349. |
| [5] | Wenjuan DUO, Yixiang WANG, Jiaxing WANG, Xinlong XU, Linxian LI, Dongchen YANG, Qili SHEN, Lichun YANG, Xiaojing LIU, Qiwang JING, Liang CHU, Xiaodi YANG. Schistosoma japonicum cystatin has protective effects against "two-hit" sepsis in mice by regulating the inflammatory microenvironment [J]. Journal of Southern Medical University, 2025, 45(1): 110-117. |
| [6] | Jing ZENG, Rong CHEN, Xiangyi REN, Lei HUA, Yong YANG, Jiangping WEI, Xiaomei ZHANG. Yigong San improves cognitive decline in a rat model of Alzheimer's disease by regulating intestinal microorganisms [J]. Journal of Southern Medical University, 2024, 44(7): 1297-1305. |
| [7] | ZHANG Xiaohong, ZHAO Pin, KUAI Jianke, CHANG Chao, YUAN Qing. Spermidine alleviates lipopolysaccharide-induced myocardial injury in mice by suppressing apoptosis, ROS production and ferroptosis [J]. Journal of Southern Medical University, 2024, 44(1): 166-172. |
| [8] | WANG Liya, TIAN Meihui, LI Rong, WU Yue, WANG Shasha, LÜ Heng, LIU Zhongyi, YU Ying. Acetaldehyde dehydrogenase 2 ameliorates lung endothelial barrier and balances mitochondrial dynamics in mice with acute lung injury [J]. Journal of Southern Medical University, 2023, 43(8): 1388-1395. |
| [9] | LIN Jiayi, LOU Anni, LI Xu. Lipopolysaccharide stimulates macrophages to secrete exosomes containing miR-155-5p to promote activation and migration of hepatic stellate cells [J]. Journal of Southern Medical University, 2023, 43(6): 994-1001. |
| [10] | HU Ke, CAO Xiangyu, LI Yuxian, LIU Lingli, CHEN Yuefu, CHEN Lijun, HUANG Minjiang, TAN Bifeng, YIN Huiming. Coactivator p300-induced H3K27 acetylation mediates lipopolysaccharide-induced inflammatory mediator synthesis [J]. Journal of Southern Medical University, 2022, 42(3): 321-329. |
| [11] | YUAN Qiao, XIE Liying, CHEN Chaojun. Astragalus polysaccharide protects against blood-brain barrier damage in MCAO rats by inhibiting P2X7R channel [J]. Journal of Southern Medical University, 2022, 42(11): 1705-1711. |
| [12] | . 2, 3, 5, 4'-tetrahydroxystilbene-2-O-β-d-glucoside alleviates lipopolysaccharide-induced acute lung injury in rats [J]. Journal of Southern Medical University, 2021, 41(7): 1101-1106. |
| [13] | . Synergistic effect of polysaccharide from Trichoderma pseudokoningii and oxaliplatin on colorectal cancer cells in vitro [J]. Journal of Southern Medical University, 2021, 41(4): 504-513. |
| [14] | . Research progress in the role and mechanism of polysaccharides in regulating glucose and lipid metabolism [J]. Journal of Southern Medical University, 2021, 41(3): 471-474. |
| [15] | CAI Suna, LI Qiang, ZHOU Hui, XU Yumo, SONG Jing, GAN Chao, QI Zhilin, QI Shimei. Mechanism of PI3K/AKT/mTOR signaling pathway for mediating anti-inflammatory and anti-oxidant effects of chrysin: a protein microarray-based study [J]. Journal of Southern Medical University, 2021, 41(10): 1554-1561. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||