Overexpression of miR-183-5p enhances malignant phenotype and inhibits ferroptosis of triple-negative breast cancer cells by negatively regulating KLHL24

doi:10.12122/j.issn.1673-4254.2026.08.07

Abstract

Abstract:

Objective To investigate the effects of miR-183-5p overexpression on proliferation, invasion, migration, and ferroptosis of triple-negative breast cancer (TNBC) cells and the role of Kelch-like protein 24 (KLHL24) in mediating these effects. Methods Bioinformatics analyses were conducted to screen differentially expressed genes in breast cancer (BRCA) and predict the target gene of miR-183-5p. RT-qPCR was used to verify miR-183-5p expression in normal breast epithelial and TNBC cell lines. Dual-luciferase reporter assay was performed to confirm direct binding of miR-183-5p to 3'-UTR of KLHL24. Western blotting was used to detect KLHL24 expression in different TNBC cells after transfection with miR-183-5p-overexpressing plasmids. MDA-MB-231 cells were co-transfected with NC-miR and NC-KLHL24, oe-miR-183-5p and NC-KLHL24, NC-miR and oe-KLHL24, or oe-miR-183-5p and oe-KLHL24 plasmids, and the changes in cell proliferation, migration and invasion were examined using EdU, Transwell, and wound healing assays. Western blotting was used to detect the changes in expressions of ferroptosis-related proteins (GPX4, SLC7A11, and Nrf2), and ROS, LPO, MDA, and GSH levels in the transfected cells were determined. Results The expression of miR-183-5p was significantly elevated in BRCA tissues and TNBC cell lines, and MDA-MB-231 cells showed the highest miR-183-5p expression. Dual-luciferase reporter assay confirmed the direct binding of miR-183-5p to 3'-UTR of KLHL24. Overexpression of miR-183-5p significantly downregulated KLHL24 expression. In TNBC cells, miR-183-5p overexpression obviously promoted cell proliferation, invasion, and migration, upregulated the expressions of GPX4, SLC7A11 and Nrf2, reduced the levels of ROS, LPO and MDA, and increased the level of GSH (P<0.0001); these effects were significantly reversed by co-transfection of the cells with KLHL24-overexpressing plasmids. Conclusion Overexpression of miR-183-5p enhances TNBC cell proliferation, invasion, migration and inhibits ferroptosis by negatively regulating KLHL24.

Key words: triple-negative breast cancer, miR-183-5p, KLHL24, proliferation, invasion and migration, ferroptosis

Kun WANG, Shunfu HOU, Yong LI, Qinghua LIU, Chonggao YIN, Hongli LI. Overexpression of miR-183-5p enhances malignant phenotype and inhibits ferroptosis of triple-negative breast cancer cells by negatively regulating KLHL24[J]. Journal of Southern Medical University, 2026, 46(8): 1790-1798.

Figures/Tables 7

Tab.1 Datasets used for screening differential expression genes in breast cancer

Dataset ID	GPL Platform	Number of normal breast tissue samples	Number of breast cancer tissue samples
GSE38167	GPL14943	23	31
GSE40525	GPL8227	59	61
GSE45666	GPL14767	15	101
GSE59247	GPL15019	4	44

Tab.2 Primer sequences for RT-qPCR of miR-183-5p and U6

Name Primer sequence

miR-183-5p Forward: 5'- AGCGAGGCTATGGCACTGGTA -3'

Reverse: 5'- ATCCAGTGCAGGGTCCGAGG -3'

RT Primer:5'-GTCGTATCCAGTGCAGGG TCCGAGG

TATTCGCACTGGATACGACAGTGAA -3'

U6 Forward: 5'-CTCGCTTCGGCAGCACA-3'

Reverse: 5'-AACGCTTCACGAATTTGCGT-3'

Fig.1 Screening of target miRNAs. A: Venn diagram of differentially expressed genes in the GSE38167, GSE40525, GSE45666, GSE59247, and TCGA‑BRCA datasets. B-F: Expression levels of miR‑183 in each dataset. G: Expression of miR‑183‑3p in the TCGA database. H: Expression of miR‑183‑5p in the TCGA database. I: Volcano plot of differential miRNA analysis in the TCGA‑BRCA dataset. *P<0.05, **P<0.01, ***P<0.001 vs normal breast group.

Fig.2 Prediction and functional analysis of miR-183-5p target genes associated with breast cancer. A: Venn diagram of predicted genes. B: Expression of KLHL24 in the TCGA‑BRCA dataset. C: Expression of ATF2 in the TCGA‑BRCA dataset. D: Expression of RBMS1 in the TCGA‑BRCA dataset. E: Kaplan‑Meier Plotter analysis of survival curves for high/low KLHL24 expression groups in BRCA patients. F: Kaplan‑Meier Plotter analysis of survival curves for high/low ATF2 expression groups in BRCA patients. G: Kaplan‑Meier Plotter analysis of survival curves for high/low RBMS1 expression groups in BRCA patients. H: Western blotting for detection of KLHL24 in MDA‑MB‑231 cells after transfection with miR‑183‑5p-overexpressing plasmid. I: Changes in ATF2 protein expression. J: Quantitative analysis of the relative expression of KLHL24 from Western blotting results. K: Quantitative analysis of the relative expression of ATF2 from Western blotting results. L: Expression of miR‑183‑5p in various cell lines. *P<0.05, ***P<0.001, ****P<0.0001 vs normal group.NC/MCF-10A.

Fig.3 Dual-luciferase assay for verifying direct binding of miR-183-5p to 3'UTR of KLHL24. ***P<0.001 vs NC-miR group.

Fig.4 Overexpression of miR-183-5p promotes proliferation, migration and invasion of TNBC cells.A, B: EdU assay for assessing cell proliferation (Scale bar=100 μm). C, D: Wound healing assay for assessing cell migration (Scale bar=500 μm). E, F: Transwell cell assay for assessing cell invasion (Scale bar=100 μm). ***P<0.001, ****P<0.0001 vs NC-miR+NC-KLHL24 group.

Fig.5 Overexpression of miR-183-5p inhibits ferroptosis of triple-negative breast cancer (TNBC) cells by targeting KLHL24. A, B: Overexpression of miR-183-5p reduces while overexpression of KLHL24 increase ROS and LPO levels in TNBC cells (Scale bar=50 μm). C, D: Overexpression of miR-183-5p decreases MDA and elevated GSH levels in TNBC cells, and KLHL24 overexpression reverses these effects. E-H: Overexpression of miR‑183‑5p upregulates expressions GPX4, SLC7A11 and Nrf2, whereas KLHL24 overexpression downregulates their expressions and attenuates the effects of miR‑183‑5p overexpression.*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs NC-miR+NC-KLHL24 group.

References 29

[1]	Popa MT, Noditi A, Peleaşa TM, et al. Breast cancer: a heterogeneous pathology. prognostic and predictive factors-a narrative review[J]. Chirurgia, 2025, 120(1): 32. doi：10.21614/chirurgia.3100
[2]	Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-63. doi：10.3322/caac.21834
[3]	Rajput S, Sharma PK, Malviya R. Biomarkers and treatment strategies for breast cancer recurrence[J]. Curr Drug Targets, 2023, 24(15): 1209-20. doi：10.2174/0113894501258059231103072025
[4]	Park M, Kim D, Ko S, et al. Breast cancer metastasis: mechanisms and therapeutic implications[J]. Int J Mol Sci, 2022, 23(12): 6806. doi：10.3390/ijms23126806
[5]	Kumar S, Ziegler Y, Plotner BN, et al. Resistance to FOXM1 inhibitors in breast cancer is accompanied by impeding ferroptosis and apoptotic cell death[J]. Breast Cancer Res Treat, 2024, 208(2): 307-20. doi：10.1007/s10549-024-07420-9
[6]	Zagami P, Carey LA. Triple negative breast cancer: Pitfalls and progress[J]. npj Breast Cancer, 2022, 8: 95. doi：10.1038/s41523-022-00468-0
[7]	Zhu SL, Wu YZ, Song B, et al. Recent advances in targeted strategies for triple-negative breast cancer[J]. J Hematol Oncol, 2023, 16(1): 100. doi：10.1186/s13045-023-01497-3
[8]	Dixon SJ, Lemberg KM, Lamprecht MR, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death[J]. Cell, 2012, 149(5): 1060-72. doi：10.1016/j.cell.2012.03.042
[9]	Huang GQ, Cai YW, Ren MH, et al. Salidroside sensitizes Triple-negative breast cancer to ferroptosis by SCD1-mediated lipogenesis and NCOA4-mediated ferritinophagy[J]. J Adv Res, 2025, 74: 589-607. doi：10.1016/j.jare.2024.09.027
[10]	Lorito N, Subbiani A, Smiriglia A, et al. FADS1/2 control lipid metabolism and ferroptosis susceptibility in triple-negative breast cancer[J]. EMBO Mol Med, 2024, 16(7): 1533-59. doi：10.1038/s44321-024-00090-6
[11]	Liu WH, Jiang CJ, Ma Y, et al. The impact of ferroptosis and ferroptosis-related non-coding RNAs on breast cancer progression[J]. Front Cell Dev Biol, 2024, 12: 1506492. doi：10.3389/fcell.2024.1506492
[12]	Sun T, Zhang PH, Zhang QY, et al. Transcriptome analysis reveals PRKCA as a potential therapeutic target for overcoming cisplatin resistance in lung cancer through ferroptosis[J]. Heliyon, 2024, 10(10): e30780. doi：10.1016/j.heliyon.2024.e30780
[13]	Lei G, Zhuang L, Gan BY. The roles of ferroptosis in cancer: Tumor suppression, tumor microenvironment, and therapeutic interventions[J]. Cancer Cell, 2024, 42(4): 513-34. doi：10.1016/j.ccell.2024.03.011
[14]	Cortez MA, Ivan C, Zhou P, et al. microRNAs in cancer: from bench to bedside[J]. Adv Cancer Res, 2010, 108: 113-57.
[15]	Ho PTB, Clark IM, Le LTT. microRNA-based diagnosis and therapy[J]. Int J Mol Sci, 2022, 23(13): 7167. doi：10.3390/ijms23137167
[16]	Bartel DP. microRNAs genomics, biogenesis, mechanism, and function[J]. Cell, 2004, 116(2): 281-97. doi：10.1016/s0092-8674(04)00045-5
[17]	Huang LH, Wang XL, Zhang SY, et al. FAM46B inhibits CS-induced oxidative stress and ferroptosis in bronchial epithelial cells via KLHL24[J]. Int Immunopharmacol, 2025, 165: 115465. doi：10.1016/j.intimp.2025.115465
[18]	Abdi E, Latifi-Navid S, Latifi-Navid H. LncRNA polymorphisms and breast cancer risk[J]. Pathol Res Pract, 2022, 229: 153729. doi：10.1016/j.prp.2021.153729
[19]	Filippova EA, Pronina IV, Lukina SS, et al. LncRNA interactomes and co-methylation in breast cancer regulation[J]. Biomol Biomed, 2025, 25(11): 2481-95. doi：10.17305/bb.2025.12333
[20]	Li Y, Zeng QA, Qiu JL, et al. miR-183-5p promotes proliferation, metastasis and angiogenesis in breast cancer cells through negatively regulating four and a half LIM protein 1[J]. J Breast Cancer, 2020, 23(4): 355-72. doi：10.4048/jbc.2020.23.e47
[21]	Jin L, Luo Y, Zhao YC, et al. miR-183-5p promotes tumor progression of osteosarcoma and predicts poor prognosis in patients[J]. Cancer Manag Res, 2021, 13: 805-14. doi：10.2147/cmar.s285909
[22]	Feng YH, Wang K, Qin MC, et al. miR-183-5p promotes migration and invasion of prostate cancer by targeting TET1[J]. BMC Urol, 2023, 23(1): 116. doi：10.1186/s12894-023-01286-7
[23]	Han C, Mo KN, Jiang L, et al. miR-183-5p promotes proliferation, invasion, and glycolysis of thyroid carcinoma cells by targeting FOXO1[J]. Mol Cell Biochem, 2022, 477(4): 1195-206. doi：10.1007/s11010-022-04357-9
[24]	Chen JH, Zhou DB, Liao HY, et al. miR-183-5p regulates ECM and EMT to promote non-small cell lung cancer progression by targeting LOXL4[J]. J Thorac Dis, 2023, 15(4): 1734-48. doi：10.21037/jtd-23-329
[25]	Shu LZ, Li XY, Liu ZL, et al. Bile exosomal miR-182/183-5p increases cholangiocarcinoma stemness and progression by targeting HPGD and increasing PGE2 generation[J]. Hepatology, 2024, 79(2): 307-22. doi：10.1097/hep.0000000000000437
[26]	Vermeer MCSC, Bolling MC, Bliley JM, et al. Gain-of-function mutation in ubiquitin ligase KLHL24 causes desmin degradation and dilatation in hiPSC-derived engineered heart tissues[J]. J Clin Investig, 2021, 131(17): e140615. doi：10.1172/jci140615
[27]	Jiang G, Jin P, Xiao X, et al. Identification and validation of a novel CD8⁺ T cell-associated prognostic model based on ferroptosis in acute myeloid leukemia[J]. Front Immunol, 2023, 14: 1149513. doi：10.3389/fimmu.2023.1149513
[28]	Zhou CT, Li AH, Liu S, et al. Identification of an 11-autophagy-related-gene signature as promising prognostic biomarker for bladder cancer patients[J]. Biology, 2021, 10(5): 375. doi：10.3390/biology10050375
[29]	Zhao DH, Hou F, Li MJ, et al. A novel KLHL6/KLHL24 intergenic region-NTRK3 fusion in a patient with lung squamous cell carcinoma[J]. Lung Cancer, 2021, 155: 193-5. doi：10.1016/j.lungcan.2021.03.001