Astragaloside IV alleviates D-GAL-induced endothelial cell senescence by promoting mitochondrial autophagy via inhibiting the PINK1/Parkin pathway

doi:10.12122/j.issn.1673-4254.2025.11.15

Abstract

Abstract:

Objective To explore the mechanism by which astragaloside IV (AS-IV) alleviates D-galactose (D-GAL)-induced senescence in human umbilical vein endothelial cells (HUVECs). Methods Cultured HUVECs were treated with D-GAL (40 g/L), AS-IV (200 μmol/L), D-GAL+AS-IV, or D-GAL+AS-IV+MTK458 (a mitochondrial autophagy agonist, 25 μmol/L) for 48 h, and the changes in cell proliferation, migration, and angiogenesis capacity were evaluated. Cell apoptosis, reactive oxygen species (ROS) levels, mitochondrial membrane potential, and expressions of autophagy-related proteins (LC3-II/LC3-I) and PINK1/Parkin pathway proteins in the treated cells were detected. Results AS-IV treatment significantly reduced the inhibitory effect of D-GAL on HUVEC viability, effectively alleviated D-GAL-induced impairment of tube-forming ability, and promoted angiogenesis and migration ability of the cells. AS-IV also significantly reduced the rate of D-GAL-induced HUVECs positive for senescence-associated β-galactosidase (SA-β-Gal) staining and inhibited the expression of senescence-related genes P21 and P53. AS-IV restored mitochondrial membrane potential and reduced intracellular ROS levels in D-GAL-induced HUVECs, and inhibited the fusion of autophagosomes and lysosomes to prevent the completion of autophagic flux. In HUVECs treated with both D-GAL and AS-IV, the application MTK458 significantly increased the number of yellow spots and enhanced the expressions of P21, P53, PINK1, Parkin, LC3, and Beclin proteins. Conclusion AS-IV alleviates D-GAL-induced endothelial cell senescence by inhibiting the PINK1/Parkin pathway to regulate mitochondrial autophagy.

Key words: astragaloside, PINK1/Parkin signaling pathway, mitochondrial autophagy, D-galactose, endothelial cells, cellular senescence

Ming YI, Ye LUO, Lu WU, Zeheng WU, Cuiping JIANG, Shiyu CHEN, Xiao KE. Astragaloside IV alleviates D-GAL-induced endothelial cell senescence by promoting mitochondrial autophagy via inhibiting the PINK1/Parkin pathway[J]. Journal of Southern Medical University, 2025, 45(11): 2427-2437.

Figures/Tables 12

Tab.1 Primers sequences for qRT-PCR

Gene	Primer sequences (5'-3')
human-GAPDH	F:GGAGCGAGATCCCTCCAAAAT
	R:GGCTGTTGTCATACTTCTCATGG
human-TP53 (P53)	F:CAGCACATGACGGAGGTTGT
	R:TCATCCAAATACTCCACACGC
human-p21	F:TGTCCGTCAGAACCCATGC
	R:AAAGTCGAAGTTCCATCGCTC
Human-PINK1	F: GCCTCATCGAGGAAAAACAGG
	R: GTCTCGTGTCCAACGGGTC
Human-parkin	F:GTGTTTGTCAGGTTCAACTCCA
	R:GAAAATCACACGCAACTGGTC
Human-p62	F:GCACCCCAATGTGATCTGC
	R:CGCTACACAAGTCGTAGTCTGG
Human-Baclin1	F:CCATGCAGGTGAGCTTCGT
	R:GAATCTGCGAGAGACACCATC

Fig.1 Effect of AS-IV on viability of D-GAL-induced human umbilical vein endothelial cells （HUVECs）. A： Effect of different concentrations of D-GAL on HUVEC viability. B： Viability of HUVECs with different treatments. ***P<0.001, ****P<0.0001 vs NC group; ####P<0.0001 vs D-gal group.

Fig.2 Effect of AS-IV on tube formation ability of HUVEC induced by D-GAL. A： Tubule formation assay images of HUVEC cells after treatment with various groups. B： Statistical graph of the tubule formation assay （Scale bar=100 μm）, ****P<0.0001 vs NC group, ##P<0.01 vs D-GAL group.

Fig.3 Effect of AS-IV on migration ability of D-GAL-induced HUVECs. A： Observation of migration of HUVECs after different treatments (Scale bar=200 μm). B： Wound healing rates of HUVECs with different treatments. ****P<0.0001 vs NC group; ###P<0.001 vs D-GAL group.

Fig.4 Effect of AS-IV on SA‑β‑Gal staining positivity rate in D-GAL-induced HUVECs. A： SA‑β-Gal staining of HUVEC cells with different treatments (Scale bar=100 μm). B： SA-β-Gal staining positiving rates of the cells. ****P<0.0001 vs NC group; ##P<0.01 vs D-GAL group.

Fig.5 Effect of AS-IV on the Expression of P21 and P53 in D-GAL-Induced HUVEC Cells. A: Protein band diagram of P53 and P21 in four groups of cells. B, C: Statistical graph of P21 and P53 gene and protein expression.****P<0.0001 vs NC group; #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs D-GAL group.

Fig.6 Effect of AS-IV on mitochondrial membrane potential in D-GAL-induced HUVECs (Scale bar=50 μm).

Fig.7 Effect of AS-IV on percentage of ROS-positive HUVECs induced by D-GAL. A： ROS levels in HUVEC cells with different treatments. B： Statistical graph of ROS levels. ****P<0.0001 vs NC group; ####P<0.0001 vs D-gal group.

Fig.8 Effect of AS-IV on autophagosome-lysosome fusion and autophagy flux in D-GAL-induced HUVECs. A： Autophagy flux assay of HUVECs with different treatments (Scale bar=50 μm). B： Statistical graph of puncta counts. ****P<0.0001 vs control group; ####P<0.0001 vs D-GAL group.

Fig.9 Effect of AS-IV on expression of PINK1/Parkin pathway and autophagy-related proteins in D-GAL-induced HUVECs. A： Protein bands of P62, LC3II/I, Beclin, PINK1, and Parkin in the 4 groups. B： Relative mRNA expressions of P62, Beclin, PINK, and Parkin. C： Statistical graph of grayscale values of the protein bands of P62, LC3II/I, Beclin, PINK1, and Parkin. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs NC group; #P<0.05, ###P<0.001, ####P<0.0001 vs D-gal group.

Fig.10 Effect of MTK458 on autophagosome-lysosome fusion and autophagy flux in D-GAL-induced HUVECs. A： Autophagy flux assay of HUVECs with different treatments (Scale bar=50 μm). B： Statistical graph of puncta counts. ****P<0.0001 vs NC group; ####P<0.0001 vs D-gal group; △△△△P<0.0001 vs D-gal+AS-IV group.

Fig.11 Effect of MTK458 on the PINK1/Parkin pathway and expressions of proteins related to cellular senescence and autophagy in D-GAL-induced HUVECs. A： Protein bands in the 5 groups of cells. B： Statistical graph of grayscale values of the protein bands. **P<0.01, ***P<0.001 vs NC group; #P<0.05, ##P<0.01, ###P<0.001 vs D-gal group; △P<0.05, △△△P<0.001 vs D-gal+AS-IV group.

References 37

[1]	Campisi J, Andersen JK, Kapahi P, et al. Cellular senescence: a link between cancer and age-related degenerative disease[J]? Semin Cancer Biol, 2011, 21(6): 354-9.
[2]	Minamino T, Miyauchi H, Yoshida T, et al. Endothelial cell senescence in human atherosclerosis: role of telomere in endothelial dysfunction[J]. Circulation, 2002, 105(13): 1541-4. doi：10.1161/01.cir.0000013836.85741.17
[3]	Bu LL, Yuan HH, Xie LL, et al. New dawn for atherosclerosis: vascular endothelial cell senescence and death[J]. Int J Mol Sci, 2023, 24(20): 15160. doi：10.3390/ijms242015160
[4]	Bloom SI, Islam MT, Lesniewski LA, et al. Mechanisms and consequences of endothelial cell senescence[J]. Nat Rev Cardiol, 2023, 20(1): 38-51. doi：10.1038/s41569-022-00739-0
[5]	Li AQ, Gao M, Liu BL, et al. Mitochondrial autophagy: molecular mechanisms and implications for cardiovascular disease[J]. Cell Death Dis, 2022, 13(5): 444. doi：10.1038/s41419-022-04906-6
[6]	Narendra DP, Youle RJ. The role of PINK1-Parkin in mitochondrial quality control[J]. Nat Cell Biol, 2024, 26(10): 1639-51. doi：10.1038/s41556-024-01513-9
[7]	齐苗苗. 黄芪甲苷通过PINK1/Parkin介导线粒体自噬改善心肌细胞氧化应激损伤的研究[D]. 兰州: 兰州大学, 2021.
[8]	Yi SL, Zheng B, Zhu Y, et al. Melatonin ameliorates excessive PINK1/Parkin-mediated mitophagy by enhancing SIRT1 expression in granulosa cells of PCOS[J]. Am J Physiol Endocrinol Metab, 2020, 319(1): E91-E101. doi：10.1152/ajpendo.00006.2020
[9]	Sun KY, Yang PY, Zhao R, et al. Matrine attenuates D-galactose-induced aging-related behavior in mice via inhibition of cellular senescence and oxidative stress[J]. Oxid Med Cell Longev, 2018, 2018: 7108604. doi：10.1155/2018/7108604
[10]	Zeng M, He YL, Yang YL, et al. Mesenchymal stem cell-derived extracellular vesicles relieve endothelial cell senescence via recovering CTRP9 upon repressing miR-674-5p in atherosclerosis[J]. Regen Ther, 2024, 27: 354-64. doi：10.1016/j.reth.2024.03.027
[11]	Chu QQ, Li YJ, Wu JC, et al. Oxysterol sensing through GPR183 triggers endothelial senescence in hypertension[J]. Circ Res, 2024, 135(7): 708-21. doi：10.1161/circresaha.124.324722
[12]	Liu MM, Wang DN, Qi CY, et al. Brain ischemia causes systemic Notch1 activity in endothelial cells to drive atherosclerosis[J]. Immunity, 2024, 57(9): 2157-72. e7. doi：10.1016/j.immuni.2024.07.002
[13]	Wang SS, Zhang X, Ke ZZ, et al. D-galactose-induced cardiac ageing: a review of model establishment and potential interventions[J]. J Cell Mol Med, 2022, 26(21): 5335-59. doi：10.1111/jcmm.17580
[14]	Kumari R, Jat P. Mechanisms of cellular senescence: cell cycle arrest and senescence associated secretory phenotype[J]. Front Cell Dev Biol, 2021, 9: 645593. doi：10.3389/fcell.2021.645593
[15]	Zhang WJ, Frei B. Astragaloside IV inhibits NF‑κB activation and inflammatory gene expression in LPS-treated mice[J]. Mediators Inflamm, 2015, 2015: 274314. doi：10.1155/2015/274314
[16]	Xu CH, Tang FT, Lu ML, et al. Pretreatment with Astragaloside IV protects human umbilical vein endothelial cells from hydrogen peroxide induced oxidative stress and cell dysfunction via inhibiting ENOS uncoupling and NADPH oxidase-ROS-NF‑κB pathway[J]. Can J Physiol Pharmacol, 2016, 94(11): 1132-40. doi：10.1139/cjpp-2015-0572
[17]	Sun YX, Ma YH, Sun FY, et al. Astragaloside IV attenuates lipopolysaccharide induced liver injury by modulating Nrf2-mediated oxidative stress and NLRP3-mediated inflammation[J]. Heliyon, 2023, 9(4): e15436. doi：10.1016/j.heliyon.2023.e15436
[18]	Xiao XL, Zheng YL, Mo Y, et al. Astragaloside IV alleviates oxidative stress-related damage via inhibiting NLRP3 infla-mmasome in a MAPK signaling dependent pathway in human lens epithelial cells[J]. Drug Dev Res, 2022, 83(4): 1016-23. doi：10.1002/ddr.21929
[19]	Qu CY, Tan XY, Hu QC, et al. A systematic review of astragaloside IV effects on animal models of diabetes mellitus and its complications[J]. Heliyon, 2024, 10(5): e26863. doi：10.1016/j.heliyon.2024.e26863
[20]	Cheng SY, Zhang XX, Feng Q, et al. Astragaloside IV exerts angiogenesis and cardioprotection after myocardial infarction via regulating PTEN/PI3K/Akt signaling pathway[J]. Life Sci, 2019, 227: 82-93. doi：10.1016/j.lfs.2019.04.040
[21]	Shen Q, Fang J, Guo HJ, et al. Astragaloside IV attenuates podocyte apoptosis through ameliorating mitochondrial dysfunction by up-regulated Nrf2-ARE/TFAM signaling in diabetic kidney disease[J]. Free Radic Biol Med, 2023, 203: 45-57. doi：10.1016/j.freeradbiomed.2023.03.022
[22]	Liang YT, Chen BQ, Liang D, et al. Pharmacological effects of astragaloside IV: a review[J]. Molecules, 2023, 28(16): 6118. doi：10.3390/molecules28166118
[23]	Wang SL, Long HJ, Hou LJ, et al. The mitophagy pathway and its implications in human diseases[J]. Signal Transduct Target Ther, 2023, 8(1): 304. doi：10.1038/s41392-023-01503-7
[24]	Ajoolabady A, Chiong M, Lavandero S, et al. Mitophagy in cardiovascular diseases: molecular mechanisms, pathogenesis, and treatment[J]. Trends Mol Med, 2022, 28(10): 836-49. doi：10.1016/j.molmed.2022.06.007
[25]	Xue A, Zhao DP, Zhao CY, et al. Study on the neuroprotective effect of Zhimu-Huangbo extract on mitochondrial dysfunction in HT22 cells induced by D-galactose by promoting mitochondrial autophagy[J]. J Ethnopharmacol, 2024, 318: 117012. doi：10.1016/j.jep.2023.117012
[26]	Zhou XH, Tan BW, Gui WW, et al. IGF2 deficiency promotes liver aging through mitochondrial dysfunction and upregulated CEBPB signaling in D-galactose-induced aging mice[J]. Mol Med, 2023, 29(1): 161. doi：10.1186/s10020-023-00752-0
[27]	Li H, Guan KF, Wang RC, et al. Synergistic effects of MFG-E8 and whey protein on mitigating d-galactose-induced sarcopenia through PI3K/AKT/PGC-1α and MAPK/ERK signaling pathways[J]. J Dairy Sci, 2024, 107(1): 9-23. doi：10.3168/jds.2023-23637
[28]	Yang L, Shi J, Wang XW, et al. Curcumin alleviates D-galactose-induced cardiomyocyte senescence by promoting autophagy via the SIRT1/AMPK/mTOR pathway[J]. Evid Based Complement Alternat Med, 2022, 2022: 2990843. doi：10.1155/2022/2990843
[29]	Li HJ, Xu JL, Zhang YN, et al. Astragaloside IV alleviates senescence of vascular smooth muscle cells through activating Parkin-mediated mitophagy[J]. Hum Cell, 2022, 35(6): 1684-96. doi：10.1007/s13577-022-00758-6
[30]	Li J, Yang DM, Li ZP, et al. PINK1/Parkin-mediated mitophagy in neurodegenerative diseases[J]. Ageing Res Rev, 2023, 84: 101817. doi：10.1016/j.arr.2022.101817
[31]	Cao YH, Chen X, Pan FQ, et al. Xinmaikang-mediated mitophagy attenuates atherosclerosis via the PINK1/Parkin signaling pathway[J]. Phytomedicine, 2023, 119: 154955. doi：10.1016/j.phymed.2023.154955
[32]	Zhao XP, Wang Z, Wang LJ, et al. The PINK1/Parkin signaling pathway-mediated mitophagy: a forgotten protagonist in myocardial ischemia/reperfusion injury[J]. Pharmacol Res, 2024, 209: 107466. doi：10.1016/j.phrs.2024.107466
[33]	He HL, Huang WY, Xiong LD, et al. FUNDC1-mediated mitophagy regulates photodamage independently of the PINK1/Parkin-dependent pathway[J]. Free Radic Biol Med, 2024, 225: 630-40. doi：10.1016/j.freeradbiomed.2024.10.272
[34]	Chen CY, Bu XL, Deng LP, et al. Astragaloside IV as a promising therapeutic agent for liver diseases: current landscape and future perspectives[J]. Front Pharmacol, 2025, 16: 1574154. doi：10.3389/fphar.2025.1574154
[35]	Liu T, Ai L, Jiang AB, et al. Astragaloside IV suppresses the proliferation and inflammatory response of human epidermal keratinocytes and ameliorates imiquimod-induced psoriasis-like skin damage in mice[J]. Allergol Immunopathol (Madr), 2024, 52(5): 44-50. doi：10.15586/aei.v52i5.1140
[36]	Xia DQ, Li WJ, Tang C, et al. Astragaloside IV, as a potential anticancer agent[J]. Front Pharmacol, 2023, 14: 1065505. doi：10.3389/fphar.2023.1065505
[37]	Deng LL. Astragaloside IV as potential antioxidant against diabetic ketoacidosis in juvenile mice through activating JNK/Nrf2 signaling pathway[J]. Arch Med Res, 2020, 51(7): 654-63. doi：10.1016/j.arcmed.2020.06.013