GSK484, a PAD4 inhibitor, improves endothelial dysfunction in mice with sepsis-induced lung injury by inhibiting H3Cit expression

doi:10.12122/j.issn.1673-4254.2024.12.16

Abstract

Abstract:

Objective To investigate the inhibitory effect of GSK484, a PAD4 inhibitor, on H3Cit expression following sepsis and its effects for improving sepsis-induced endothelial dysfunction. Methods Eighteen C57BL/6 mice were randomized into sham-operated group, sepsis model group and GSK484 treatment group (n=6), and in the latter two groups, models of sepsis were established by cecal ligation and puncture (CLP). The mice in GSK484 treatment group were given an intraperitoneal injection of GSK484 (4 mg/kg) on the second day following the surgery. Twenty-four hours after the injection, the mice were euthanized for measurement of serum levels of VEGF, ESM-1, IL-6 and IL-1β using ELISA. Lung tissue pathology was observed with HE staining, and pulmonary expressions of F-actin, VE-cadherin, ZO-1 and H3Cit proteins were detected using immunofluorescence staining and Western blotting. In primary cultured of mouse lung microvascular endothelial cells, the effect of stimulation with LPS (10 μg/mL) for 24 h on tube formation, proliferation, apoptosis and expressions of VEGF, ESM-1, IL-6 and IL-1β were assessed using CCK-8 assay, flow cytometry and ELISA. Results Compared to the sham-operated mice, the septic mice exhibited significant lung tissue pathologies characterized by vascular congestion, alveolar rupture, edema, and neutrophil infiltration. Serum levels of IL-6, IL-1β, VEGF, and ESM-1 were elevated, pulmonary expressions of F-actin, VE-cadherin, and ZO-1 were decreased, and H3Cit expression was increased significantly in the septic mice. GSK484 treatment effectively mitigated these changes in the septic mice. The LPS-stimulated endothelial cells showed increased productions of IL-6, IL-1β, VEGF and ESM-1, which were significantly reduced after treatment with 2.5 μmol/L GSK484. Conclusion GSK484 treatment effectively suppresses H3Cit expression in septic mice to ameliorate sepsis-induced endothelial dysfunction.

Key words: sepsis, lung injury, PAD4 inhibitor, mouse pulmonary microvascular endothelial cells, endothelial dysfunction, GSK484

Xiaofei SU, Lin LI, Jingrong DAI, Bao XIAO, Ziqi JIN, Bin LIU. GSK484, a PAD4 inhibitor, improves endothelial dysfunction in mice with sepsis-induced lung injury by inhibiting H3Cit expression[J]. Journal of Southern Medical University, 2024, 44(12): 2396-2403.

Figures/Tables 9

Tab.1 Primer sequence

Primers	F (5'-3')	R (5'-3')
β-actin	AGGGAAATCGTGCGTGAC	CATACCCAAGAAGGAAGGCT
IL-6	TCCGGAGAGGAGACTTCACA	TTGCCATTGCACAACTCTTTTC
IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG

Fig. 1 HE staining (Original magnification: ×400) and pathological score (n=3) of mouse lung tissue. *P<0.05 vs Sham group; #P<0.05 vs cecal ligation and puncture (CLP) group.

Fig.2 Alterations in serum levels of vascular endothelial-related and inflammatory factors in septic mice in different groups (n=6). *P<0.05 vs Sham group; #P<0.05 vs CLP group.

Fig.3 Analysis of F-actin, VE-cadherin and ZO-1 expressions in mouse lung tissues in different groups using immunofluorescence staining (×400, n=3). *P<0.05 vs sham group; #P<0.05 vs CLP group.

Fig.4 VE-Cadherin and H3Cit protein expressions in mouse lung tissues in different groups detected by Western blotting (n=3). *P<0.05 vs sham group; #P<0.05 vs CLP group.

Fig.5 Immunohistofluorescent detection of CD31 in primary mouse lung vascular endothelial cells (×400).

Fig.6 Cell proliferation rate and mRNA expression levels of IL-6 and IL-1β. A. The cell proliferation rate was assessed with CCK-8 assay after a 3-h treatment with GSK484 at different concentrations. B: mRNA expression levels of IL-6 and IL-1β measured by RT-qPCR after a 24-h exposure to LPS at different concentrations. *P<0.05 vs 0 μmol/L group.

Fig.7 Effect of GSK484 on tube-forming ability of LPS-induced mouse lung vascular endothelial cells.*P<0.05 vs control group; #P<0.05 vs LPS group.

Fig.8 Effect of GSK484 on levels of vascular endothelial-related and inflammatory factors in the supernatants of LPS-induced mouse lung vascular endothelial cells. *P<0.05 vs control group; #P<0.05 vs LPS group.

References 29

1	Singer M, Deutschman CS, Seymour CW, et al. The third international consensus definitions for sepsis and septic shock (sepsis-3)[J]. JAMA, 2016, 315(8): 801-10.
2	Sevransky JE, Martin GS, Shanholtz C, et al. Mortality in sepsis versus non-sepsis induced acute lung injury[J]. Crit Care, 2009, 13(5): R150.
3	Gu WJ, Wan YD, Tie HT, et al. Risk of acute lung injury/acute respiratory distress syndrome in critically ill adult patients with pre-existing diabetes: a meta-analysis[J]. PLoS One, 2014, 9(2): e90426.
4	Kovach MA, Standiford TJ. The function of neutrophils in sepsis[J]. Curr Opin Infect Dis, 2012, 25(3): 321-7.
5	Chang JH, Chen FQ, Li H, et al. Three-dimensional covalent organic frameworks with nia nets for efficient separation of benzene/cyclohexane mixtures[J]. Nat Commun, 2024, 15(1): 813.
6	Su YF, Li DG, Deng SY, et al. Prognostic value of coagulation and fibrinolysis function indexes and NETs for sepsis patients[J]. Am J Transl Res, 2023, 15(6): 4164-71.
7	Zhang H, Wu D, Wang Y, et al. Ferritin-mediated neutrophil extracellular traps formation and cytokine storm via macrophage scavenger receptor in sepsis-associated lung injury[J]. Cell Commun Signal, 2024, 22(1): 97.
8	Zhu D, Lu Y, Hu B, et al. Highly-tumor-targeted PAD4 inhibitors with PBA modification inhibit tumors in vivo by specifically inhibiting the PAD4-H3cit-NETs pathway in neutrophils[J]. Eur J Med Chem, 2023, 258: 115619.
9	Shang BQ, Gu ZR, Qu W, et al. Neutrophil extracellular trap as a predictive marker to cisplatin-based chemotherapy for patients with muscle-invasive bladder cancer[J]. J Clin Oncol, 2023, 41(): e16600.
10	Jackson Chornenki NL, Coke R, Kwong AC, et al. Comparison of the source and prognostic utility of cfDNA in trauma and sepsis[J]. Intensive Care Med Exp, 2019, 7(1): 29.
11	Biron BM, Chung CS, O'Brien XM, et al. Cl-amidine prevents histone 3 citrullination and neutrophil extracellular trap formation, and improves survival in a murine sepsis model[J]. J Innate Immun, 2017, 9(1): 22-32.
12	KNMYMHTFOhta. Citrullinated Histone H3: Early biomarker of neutrophil extracellular traps in septic liver damage[J]. J Surg Res, 2019, 234: 132-8.
13	Dragoni G, Ke BJ, Picariello L, et al. The impact of PAD4-dependent neutrophil extracellular trap formation on the early development of intestinal fibrosis in Crohn's disease[J]. J Crohns Colitis, 2024: jjae121.
14	Zeineddine HA, Hong SH, Peesh P, et al. Neutrophils and neutrophil extracellular traps cause vascular occlusion and delayed cerebral ischemia after subarachnoid hemorrhage in mice[J]. Arterioscler Thromb Vasc Biol, 2024, 44(3): 635-52.
15	Du MJ, Yang L, Gu JM, et al. Inhibition of peptidyl arginine deiminase-4 prevents renal ischemia-reperfusion-induced remote lung injury[J]. Mediators Inflamm, 2020, 2020: 1724206.
16	Zhang J, Wang XB, Peng YH, et al. Combined metabolomic and proteomic analysis of sepsis related acute liver injury and its patho-genesis research[J]. Int Immunopharmacol, 2024, 130: 111666.
17	Liu H, Wang JY, Li SF, et al. The unfolded protein response pathway as a possible link in the pathogenesis of COVID-19 and sepsis[J]. Arch Virol, 2024, 169(2): 20.
18	Xie SH, Li JX, Lyu FY, et al. Novel tripeptide RKH derived fromAkkermansia muciniphilaprotects against lethal sepsis[J]. Gut, 2024, 73(1): 78-91.
19	Wang W, Chu C, Wang P, Cui H, alYAPet 1 /HIF-1α can improve sepsis-induced ALI by regulating the level of autophagy and balancing the M1-M2 polarization of macrophages[J]. J Biological Regulators and Homeostatic Agents, 2024, 38(1): 429-437.
20	Zhao L, Zhang ZL, Li P, et al. Bakuchiol regulates TLR4/MyD88/NF‑κB and Keap1/Nrf2/HO-1 pathways to protect against LPS-induced acute lung injury in vitro and in vivo [J]. Naunyn Schmiedebergs Arch Pharmacol, 2024, 397(5): 3301-12.
21	Herold S, Gabrielli NM, Vadász I. Novel concepts of acute lung injury and alveolar-capillary barrier dysfunction[J]. Am J Physiol Lung Cell Mol Physiol, 2013, 305(10): L665-81.
22	Yao W. Macrophage BRCC3 ameliorates sepsis-induced kidney injury by mediating renal NLRP3 inflammation[J]. Nephrology Dialysis Transplantation, 2024, 11(39):2-1.
23	Schleier M, Lubig J, Kehl S, et al. Diagnostic utility of interleukin-6 in early-onset sepsis among term newborns: impact of maternal risk factors and CRP evaluation[J]. Children, 2023, 11(1): 53.
24	Li Q, Ke LM, Yu DD, et al. Discovery of D25, a potent and selective MNK inhibitor for sepsis-associated acute spleen injury[J]. J Med Chem, 2024, 67(4): 3167-89.
25	May CN, Ow CP, Pustovit RV, et al. Reversal of cerebral ischaemia and hypoxia and of sickness behaviour by megadose sodium ascorbate in ovine Gram-negative sepsis[J]. Br J Anaesth, 2024, 133(2): 316-25.
26	Lartey NL, Vargas-Robles H, Guerrero-Fonseca IM, et al. The actin-binding protein cortactin promotes sepsis severity by supporting excessive neutrophil infiltration into the lung[J]. Biomedicines, 2022, 10(5): 1019.
27	Bai YY, Mi W, Meng XY, et al. Hydrogen alleviated cognitive impairment and blood-brain barrier damage in sepsis-associated encephalopathy by regulating ABC efflux transporters in a PPARα-dependent manner[J]. BMC Neurosci, 2023, 24(1): 37.
28	Su QY, Su CH, Zhang Y, et al. Adjudin protects blood-brain barrier integrity and attenuates neuroinflammation following intracerebral hemorrhage in mice[J]. Int Immunopharmacol, 2024, 132: 111962.
29	Molinaro R, Yu M, Sausen G, et al. Targeted delivery of protein arginine deiminase-4 inhibitors to limit arterial intimal NETosis and preserve endothelial integrity[J]. Cardiovasc Res, 2021, 117(13): 2652-63.

[1]	Kai CHEN, Zhaofei MENG, Jingting MIN, Jiahui WANG, Zhenghong LI, Qin GAO, Junfeng HU. Curcumin alleviates septic lung injury in mice by inhibiting TXNIP/TRX-1/GPX4-mediated ferroptosis [J]. Journal of Southern Medical University, 2024, 44(9): 1805-1813.
[2]	ZHU Qi, LU Yunxiang, PENG You, HE Jiale, WEI Zeyu, LI Zhiyong, CHEN Yuxian. α2-macroglobulin alleviates glucocorticoid-induced avascular necrosis of the femoral head in mice by promoting proliferation, migration and angiogenesis of vascular endothelial cells [J]. Journal of Southern Medical University, 2024, 44(4): 712-719.
[3]	YANG Yang, LIU Gang, OU Yi, LU Wenqi. Lung-protective effect of esketamine combined with distal limb ischemic preconditioning in elderly patients undergoing thoracoscopic radical surgery for lung cancer: a randomized controlled trial in 160 cases [J]. Journal of Southern Medical University, 2024, 44(3): 484-490.
[4]	FANG Shangping, SUN Renke, SU Hui, ZHAI Kecheng, XIANG Yu, GAO Yangmengna, GUO Wenjun. Chlorogenic acid alleviates acute kidney injury in septic mice by inhibiting NLRP3 inflammasomes and the caspase-1 canonical pyroptosis pathway [J]. Journal of Southern Medical University, 2024, 44(2): 317-323.
[5]	LING Xuguang, XU Wenwen, PANG Guanlai, HONG Xuxing, LIU Fengqin, LI Yang. Tea polyphenols ameliorates acute lung injury in septic mice by inhibiting NLRP3 inflammasomes [J]. Journal of Southern Medical University, 2024, 44(2): 381-386.
[6]	Ruoli DU, Qi YUN, Yiren WANG, Xinyu DOU, Hongwei YE, Jiahui WANG, Qin GAO. Plumbagin protect against sepsis-induced myocardial injury in mice by inhibiting the JAK2/STAT3 signaling pathway to reduce cardiomyocyte pyroptosis [J]. Journal of Southern Medical University, 2024, 44(11): 2209-2219.
[7]	YU Jiachi, LI Ruibing, XIA Tian, WANG Jianan, JIN Jiacheng, YUAN Manqiu, LI Mianyang. PDCD4 knockdown ameliorates lipopolysaccharide- induced endothelial cell damage by improving mitochondrial dynamics [J]. Journal of Southern Medical University, 2024, 44(1): 25-35.
[8]	ZHANG Xiaohong, ZHAO Pin, KUAI Jianke, CHANG Chao, YUAN Qing. Spermidine alleviates lipopolysaccharide-induced myocardial injury in mice by suppressing apoptosis, ROS production and ferroptosis [J]. Journal of Southern Medical University, 2024, 44(1): 166-172.
[9]	WANG Liya, TIAN Meihui, LI Rong, WU Yue, WANG Shasha, LÜ Heng, LIU Zhongyi, YU Ying. Acetaldehyde dehydrogenase 2 ameliorates lung endothelial barrier and balances mitochondrial dynamics in mice with acute lung injury [J]. Journal of Southern Medical University, 2023, 43(8): 1388-1395.
[10]	GUO Jingjing, ZHANG Wenlong, LIANG Piao, ZHANG Longjun, PENG Lingyin, MIN Yuqi, PAN Xiaozhen, YANG Zhiying, DENG Huafei. Puerarin alleviates lipopolysaccharide-induced acute kidney injury in mice by modulating the SIRT1/NF-κB pathway [J]. Journal of Southern Medical University, 2023, 43(7): 1248-1253.
[11]	WU Songlin, LI Xuexin, GUAN Fasheng, FENG Jianguo, JIA Jing, LI Jing, LIU Li. Enhanced endoplasmic reticulum RyR1 receptor phosphorylation leads to diaphragmatic dysfunction in septic rats [J]. Journal of Southern Medical University, 2023, 43(4): 631-636.
[12]	WANG Wenfa, YANG Yong, WANG LI, GUO Xin, TIAN Lingfang, WANG He, HU Yuzhen, LIU Rui. Sevoflurane alleviates ventilator-induced lung injury in rats by down-regulating the TRPV4/C-PLA2 signaling pathway [J]. Journal of Southern Medical University, 2023, 43(11): 1886-1891.
[13]	TANG Wentao, DENG Juan, HE Sicheng, LI Junfen, ZHOU Yiqing, WANG Yan. Inhibitory effect of low-intensity pulsed ultrasound on apoptosis of splenic lymphocytes in septic rats [J]. Journal of Southern Medical University, 2023, 43(10): 1789-1795.
[14]	KANG Huiwen, JIANG Shoufang, SONG Qian, ZHANG Yili. Activation of cannabinoid receptor 2 alleviates acute lung injury in rats with lipopolysaccharide-induced sepsis [J]. Journal of Southern Medical University, 2022, 42(9): 1374-1380.
[15]	YUAN Yuan, NIAN Feng, LI Huihui, YANG Huijuan, WU Yuzhi, MA Mengxi, WANG Kaigui, CHEN Xueling, ZHANG Ziqiang, LI Gen, YANG Xiaodi, WU Qiang. Protective effect of excretory-secretory proteins from Trichinella spiralis muscle larvae against myocardial injury in septic mice [J]. Journal of Southern Medical University, 2022, 42(6): 824-831.