High expression of hexokinase 2 promotes proliferation, migration and invasion of colorectal cancer cells by activating the JAK/STAT pathway and regulating tumor immune microenvironment

doi:10.12122/j.issn.1673-4254.2025.03.12

Abstract

Abstract:

Objective To explore the expression of hexokinase 2 (HK2) in colorectal cancer (CRC) and its possible mechanisms for regulating tumor cell behaviors and tumor immune microenvironment. Methods We analyzed HK2 expression in CRC and its impact on patient prognosis and tumor immune microenvironment using public databases. HK2 expression was also examined in 8 CRC and paired adjacent tissues using immunohistochemistry, Western blotting and RT-qPCR. In cultured CRC cell lines CT26 and HCT116 with low HK2 expression, the effects of lentivirus-mediated HK2 overexpression and JAK/STAT3 inhibitors on cell proliferation, migration, and invasion were assessed using CCK-8 assay, colony formation assay and Transwell assay and in a subcutaneous tumor-bearing mouse model; the changes were also observed in MC38 and CACO2 cells with high HK2 expressions following treatment with HK2 inhibitor 3-BP. Western blotting was performed to verify the relationship between HK2 and JAK/STAT signaling pathway protein expressions. Results Informatics analyses suggested that HK2 expression was significantly higher in CRC tissues than in adjacent tissues (P<0.001), and patients with high HK2 expressions had worse prognosis (P=0.09). In the 8 clinical CRC tissues, HK2 expressions were significantly higher in the tumor tissues than in the adjacent tissues (P<0.01). In CT26 and HCT116 cells, HK2 overexpression significantly enhanced cell proliferation, migration and invasion, while in HK2-overexpressing MC38 and CACO2 cells, inhibiting HK2 with 3-BP strongly suppressed these changes. HK2 overexpression promoted STAT3 phosphorylation, and JAK/STAT3 inhibitors effectively suppressed tumor cell proliferation, migration and invasion. TIMER and MCPcounter analyses indicated correlations between HK2 and immune cells, and TCGA and GEO analyses suggested significant positive correlations between HK2 and the immune checkpoints including PDCD1. Conclusion HK2 is upregulated in CRC to promote tumor cell proliferation, migration and invasion possibly by activating the JAK-STAT signaling pathway and modulating tumor immune microenvironment.

Key words: colorectal cancer, hexokinase 2, JAK-STAT signaling pathway, proliferation, migration and invasion, immune microenvironment

Shunjie QING, Zhiyong SHEN. High expression of hexokinase 2 promotes proliferation, migration and invasion of colorectal cancer cells by activating the JAK/STAT pathway and regulating tumor immune microenvironment[J]. Journal of Southern Medical University, 2025, 45(3): 542-553.

Figures/Tables 13

Tab.1 Primer sequence for RT-qPCR

Gene	Species	Forward primer	Reverse primer
HK2	Human	GAGCCACCACTCACCCTACT	CCAGGCATTCGGCAATGTG
Hk2	Mouse	ATGATCGCCTGCTTATTCACG	CGCCTAGAAATCTCCAGAAGGG
GAPDH	Human	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG
Gapdh	Mouse	AGGTCGGTGTGAACGGATTTG	GGGGTCGTTGATGGCAACA

Fig.1 Expression of HK2 in colorectal cancer and its association with patient prognosis. A: Expression levels of HK2 in colorectal cancer from TCGA databases. B: Kaplan-Meier survival curves of overall survival (OS) for CRC patients stratified by HK2 expression level. ****P<0.0001.

Fig.2 Expression of HK2 in clinical samples of CRC and adjacent tissues. A: Immunohistochemical staining for HK2 expression. B, C: HK2 protein and mRNA expression levels in cancer tissues and adjacent tissues. **P<0.01. T: Tumor; N: Normal.

Fig.3 Construction and validation of HK2-overexpressing CRC cells. A, B: HK2 mRNA expression in CRC cells. C-F: Protein and mRNA expression of HK2 in CT26 and HCT116 cells after lentivirus-mediated transfection. *P<0.05, **P<0.01, ****P<0.0001.

Fig.4 Effect of HK2 overexpression on proliferation ability of CRC cells in vitro. A-B: CCK-8. C-D: Colony-forming assay. ***P<0.001, ****P<0.0001.

Fig.5 Effect of HK2 overexpression on migration and invasion of CT26 cells (A, B) and HCT116 cells (C, D) (Original magnification: ×40). **P<0.01.

Fig.6 Effect of HK2 functional inhibition on the proliferation, migration, and invasion of CRC cells in vitroA-B, F: MC38. C-E: CACO2 (Original magnification: ×40). **P<0.01, ***P<0.001, ****P<0.0001.

Fig.7 Effect of HK2 overexpression on the proliferation of CRC cells in vivo. A-D: Effect of HK2 overexpression in CT26 cells on subcutaneous tumor proliferation. E: Ki-67 proliferative index of subcutaneous tumors (×40). F, G: Number of CD8+ T cells in subcutaneous tumors. **P<0.01, ***P<0.001.

Fig.8 Effect of HK2 overexpression on proliferation of HCT116 cells in nude mice. A-C: Effect of HK2 on subcutaneous tumor proliferation. *P<0.05.

Fig.9 HK2 regulates the JAK/STAT signaling pathway. A: GSEA confirms that the JAK/STAT signaling pathway is significantly enriched in CRC with high HK2 expression based on CRC data from TCGA. B-E: Western blotting showing expression levels of STAT and p-STAT after HK2 overexpression. ***P<0.001, ****P<0.0001.

Fig.10 HK2 affects biological behaviors of CRC cells through the JAK/STAT pathway. A, B: Transwell assay showing migration and invasion of CT26 (A) and HCT116 (B) cells in the NC, OE and OE+GA groups (×40). C, D: Quantification of numbers of migrating and invading cells in CT26 (C) and HCT116 (D) from the Transwell assays. E, F: Cell proliferation assessed by CCK-8 assay in CT26 (E) and HCT116 (F) cells in different groups. *P<0.05, **P<0.01, ****P<0.0001.

Fig.11 Correlation between HK2 expression and immune infiltration analyzed using MCPcounter and TIMER. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

Fig.12 Correlation between HK2 and immune checkpoints analyzed using TCGA (A) and GEO (B) databases. **P<0.01, ***P<0.001.

References 32

1	Kim S, Koh J, Song SG, et al. High tumor hexokinase-2 expression promotes a pro-tumorigenic immune microenvironment by modulating CD8⁺/regulatory T-cell infiltration[J]. BMC Cancer, 2022, 22(1): 1120.
2	Ciscato F, Ferrone L, Masgras I, et al. Hexokinase 2 in cancer: a Prima donna playing multiple characters[J]. Int J Mol Sci, 2021, 22(9): 4716.
3	Yu Q, Wang Y, Dong L, et al. Regulations of glycolytic activities on macrophages functions in tumor and infectious inflammation[J]. Front Cell Infect Microbiol, 2020, 10: 287.
4	Sung H, Ferlay J, Siegel RL, et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2021, 71(3): 209-49.
5	Li Y, Shen Z, Chai Z, et al. Targeting MS4A4A on tumour-associated macrophages restores CD8⁺ T-cell-mediated antitumour immunity[J]. Gut, 2023, 72(12): 2307-20.
6	Zou Y, Wang S, Zhang H, et al. The triangular relationship between traditional Chinese medicines, intestinal flora, and colorectal cancer[J]. Med Res Rev, 2024, 44(2): 539-67.
7	Zheng RS, Zhang SW, Zeng HM, et al. Cancer incidence and mortality in China, 2016[J]. J Natl Cancer Cent, 2022, 2(1): 1-9.
8	Rumpold H, Niedersüß-Beke D, Heiler C, et al. Prediction of mortality in metastatic colorectal cancer in a real-life population: a multicenter explorative analysis[J]. BMC Cancer, 2020, 20(1): 1149.
9	Zygowiec J. Virtually grounded[J]. JAMA, 2023, 329(12): 977.
10	Zhu J, Cai H, Xu C, et al. Acidity-responsive nanoreactors destructed “Warburg effect” for toxic-acidosis and starvation synergistic therapy[J]. Small, 2023, 19(46): e2304058.
11	Zhou Y, Guo Y, Tam KY. Targeting glucose metabolism to develop anticancer treatments and therapeutic patents[J]. Expert Opin Ther Pat, 2022, 32(4): 441-53.
12	DeWaal D, Nogueira V, Terry AR, et al. Author Correction: Hexokinase-2 depletion inhibits glycolysis and induces oxidative phosphorylation in hepatocellular carcinoma and sensitizes to metformin[J]. Nat Commun, 2018, 9: 2539.
13	Zhuang W, Liu X, Liu G, et al. Purinergic receptor P2Y12 boosts autoimmune hepatitis through hexokinase 2-dependent glycolysis in T cells[J]. Int J Biol Sci, 2023, 19(11): 3576-94.
14	Zhong J, Lu S, Jia X, et al. Role of endoplasmic reticulum stress in apoptosis induced by HK2 inhibitor and its potential as a new drug combination strategy[J]. Cell Stress Chaperones, 2022, 27(3): 273-83.
15	Zhang Y, Zhu JH, Zhou Y, et al. Activation of HIF-1α C-terminal transactivation domain promotes tubulointerstitial fibrosis through hexokinase 2-mediated metabolic reprogramming[J]. Cell Signal, 2024, 127: 111531.
16	Shangguan X, He J, Ma Z, et al. SUMOylation controls the binding of hexokinase 2 to mitochondria and protects against prostate cancer tumorigenesis[J]. Nat Commun, 2021, 12(1): 1812.
17	Wang J, Shao F, Yang Y, et al. A non-metabolic function of hexokinase 2 in small cell lung cancer: promotes cancer cell stemness by increasing USP11-mediated CD133 stability[J]. Cancer Commun: Lond, 2022, 42(10): 1008-27.
18	Zheng Y, Zhan Y, Zhang Y, et al. Hexokinase 2 confers radio-resistance in hepatocellular carcinoma by promoting autophagy-dependent degradation of AIMP2[J]. Cell Death Dis, 2023, 14(8): 488.
19	Esposito M, Ganesan S, Kang Y. Emerging strategies for treating metastasis[J]. Nat Cancer, 2021, 2(3): 258-70.
20	Sleeboom JJF, van Tienderen GS, Schenke-Layland K, et al. The extracellular matrix as hallmark of cancer and metastasis: From biomechanics to therapeutic targets[J]. Sci Transl Med, 2024, 16(728): eadg3840.
21	Tian Y, Wang Y, Wen N, et al. Prognostic factors associated with early recurrence following liver resection for colorectal liver metastases: a systematic review and meta-analysis[J]. BMC Cancer, 2024, 24(1): 426.
22	Liu QL, Zhou H, Zhou ZG, et al. Colorectal cancer liver metastasis: genomic evolution and crosstalk with the liver microenvironment[J]. Cancer Metastasis Rev, 2023, 42(2): 575-87.
23	Fang Q, Ni CD, Cai Z, et al. Prognostic significance of hsa_circ_0048122 to predict liver metastasis in early-stage colorectal cancer[J]. Clinical Laboratory Analysis, 2022, 36(8): e24577.
24	Johnson DE, O’Keefe RA, Grandis JR. Targeting the IL-6/JAK/STAT3 signalling axis in cancer[J]. Nat Rev Clin Oncol, 2018, 15(4): 234-48.
25	Zhou QL, Ren Q, Jiao LH, et al. The potential roles of JAK/STAT signaling in the progression of osteoarthritis[J]. Front Endocrinol, 2022, 13: 1069057.
26	Zalpoor H, Nabi-Afjadi M, Forghaniesfidvajani R, et al. Quercetin as a JAK-STAT inhibitor: a potential role in solid tumors and neurodegenerative diseases[J]. Cell Mol Biol Lett, 2022, 27(1): 60.
27	Xue C, Yao Q, Gu X, et al. Evolving cognition of the JAK-STAT signaling pathway: autoimmune disorders and cancer[J]. Signal Transduct Target Ther, 2023, 8(1): 204.
28	Sun YC, Gong WP, Zhang S. METTL3 promotes colorectal cancer progression through activating JAK1/STAT3 signaling pathway[J]. Cell Death Dis, 2023, 14(11): 765.
29	Wang J, Zhang Y, Song H, et al. The circular RNA circSPARC enhances the migration and proliferation of colorectal cancer by regulating the JAK/STAT pathway[J]. Mol Cancer, 2021, 20(1): 81.
30	Guo D, Tong YY, Jiang XM, et al. Aerobic glycolysis promotes tumor immune evasion by hexokinase2-mediated phosphorylation of IκBα[J]. Cell Metab, 2022, 34(9): 1312-24.e6.
31	Gu MD, Zhou XF, Sohn JH, et al. NF-κB-inducing kinase maintains T cell metabolic fitness in antitumor immunity[J]. Nat Immunol, 2021, 22(2): 193-204.
32	Cao YN, Yi YN, Han CX, et al. NF-κB signaling pathway in tumor microenvironment[J]. Front Immunol, 2024, 15: 1476030.

[1]	Kai JI, Guanyu YU, Leqi ZHOU, Tianshuai ZHANG, Qianlong LING, Wenjiang MAN, Bing ZHU, Wei ZHANG. HNRNPA1 gene is highly expressed in colorectal cancer: its prognostic implications and potential as a therapeutic target [J]. Journal of Southern Medical University, 2024, 44(9): 1685-1695.
[2]	Yinliang ZHANG, Zetan LUO, Rui ZHAO, Na ZHAO, Zhidong XU, Di AO, Guyi CONG, Xinyu LIU, Hailun ZHENG. Sanguinarine induces ferroptosis of colorectal cancer cells by upregulating STUB1 and downregulating GPX4 [J]. Journal of Southern Medical University, 2024, 44(8): 1537-1544.
[3]	Heping LI, Gaohua LI, Xuehua ZHANG, Yanan WANG. Genetic drivers for inflammatory protein markers in colorectal cancer: a Mendelian randomization approach to clinical prognosis study [J]. Journal of Southern Medical University, 2024, 44(7): 1361-1370.
[4]	Xinrong HE, Sili XIONG, Zhenru ZHU, Jingyuan SUN, Chuanhui CAO, Hui WANG. Overexpression of ubiquitin-conjugating enzyme 2T induces radiotherapy resistance in hepatocellular carcinoma by enriching regulatory T cells in the tumor microenvironment [J]. Journal of Southern Medical University, 2024, 44(6): 1149-1158.
[5]	Nan WANG, Bin SHI, Xiaolan MAN, Weichao WU, Jia CAO. High expression of fragile X mental retardation protein inhibits ferroptosis of colorectal tumor cells by activating the RAS/MAPK signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 885-893.
[6]	GAO Zhiqiang, LIN Jie, HONG Peng, HU Zaihong, DONG Junjun, SHI Qinlin, TIAN Xiaomao, LIU Feng, WEI Guanghui. Identification of key genes in Wilms tumor based on high- throughput RNA sequencing and their impacts on prognosis and immune responses [J]. Journal of Southern Medical University, 2024, 44(4): 727-738.
[7]	CHEN Shoufeng, ZHANG Shuchao, FAN Weilin, SUN Wei, LIU Beibei, LIU Jianmin, GUO Yuanyuan. Efficacy of combined treatment with pirfenidone and PD-L1 inhibitor in mice bearing ectopic bladder cancer xenograft [J]. Journal of Southern Medical University, 2024, 44(2): 210-216.
[8]	Xueyan XI, Ting DENG, Boyu DU. Colorectal fibroblasts promote malignant phenotype of colorectal cancer cells by activating the ERK signaling pathway [J]. Journal of Southern Medical University, 2024, 44(10): 1866-1873.
[9]	YAO Yina, LIU Jia, ZHOU Xiangjun, LIU Zeyu, QIU Shizhen, HE Yingzheng, ZHOU Xueqiong. A pan-cancer analysis of TTC9A expression level and its correlation with prognosis and immune microenvironment [J]. Journal of Southern Medical University, 2024, 44(1): 70-82.
[10]	YAN Chang, LIU Shuang, SONG Qingzhi, HU Yibing. Metformin inhibits self-renewal of colorectal cancer stem cells by inhibiting mitochondrial oxidative phosphorylation [J]. Journal of Southern Medical University, 2023, 43(8): 1279-1286.
[11]	WEI Ke, SHI Jiwen, XIAO Yuhan, WANG Wenrui, YANG Qingling, CHEN Changjie. MiR-30e-5p overexpression promotes proliferation and migration of colorectal cancer cells by activating the CXCL12 axis via downregulating PTEN [J]. Journal of Southern Medical University, 2023, 43(7): 1081-1092.
[12]	ZHANG Xuefang, CHEN Yanhua, LI Zongheng, SHANG Jing, YUAN Zeting, DENG Wanli, LUO Ying, HAN Na, YIN Peihao, YIN Jun. Analysis of therapeutic mechanism of Liushen Wan against colitis-associated colorectal cancer based on network pharmacology and validation in mice [J]. Journal of Southern Medical University, 2023, 43(7): 1051-1062.
[13]	DENG Ting, DU Boyu, XI Xueyan. Colorectal cancer cells induce the formation of cancer-associated fibroblasts by activating the ERK signaling pathway in fibroblasts [J]. Journal of Southern Medical University, 2023, 43(6): 943-951.
[14]	MA Zhennan, ZHAO Xuefeng, ZHANG Xiaowei, XU Guangda, LIU Fuquan. DTX2 overexpression promotes migration and invasion of colorectal cancer cells through the Notch2/Akt axis [J]. Journal of Southern Medical University, 2023, 43(3): 340-348.
[15]	WANG Xuancheng, ZHU Yifan, ZHOU Hailin, HUANG Zongsheng, CHEN Hongwei, ZHANG Jiahao, YANG Shanyi, CHEN Guanghui, ZHANG Qisong. Integrated analysis of serum untargeted metabolomics and targeted bile acid metabolomics for identification of diagnostic biomarkers for colorectal cancer [J]. Journal of Southern Medical University, 2023, 43(3): 443-453.