MiRNA-103-3p promotes neural cell autophagy by activating Wnt/β-catenin signaling via targeting rab10 in a rat model of depression

doi:10.12122/j.issn.1673-4254.2024.07.11

Abstract

Abstract:

Objective To explore the neuroprotective role of Rab10 gene in depression and the mechanism mediating its effect. Methods Forty-eight male SD rats were randomized into a control group and 3 chronic unpredictable mild stress (CUMS) groups (n=12). The rats in the latter 3 groups were subjected to injections of normal saline, an adeno-associated viral (AAV) vector, or a Rab10-overexpressing AAV vector in the lateral ventricle after CUMS modeling. The depressive behavioral changes of the rats were assessed using behavioral tests. The TargetScan database was used to predict the miRNA interacting with Rab10 and the binding sites. The interaction between miRNA-103-3p and Rab10 was investigated using dual-luciferase and radioimmunoprecipitation (RIP) assay. The effect of corticosterone treatment on PC12 cell viability was assessed with CCK-8 assay. In corticosterone-stimulated PC12 cells, the changes in BDNF, CREB, p62, Beclin-1, Wnt3a, Gsk3β, phosphorylated (p)-Gsk3β, and β-catenin protein expressions following transfection with the Rab10-overexpressing AAV vector and a miRNA-103-3p inhibitor, alone or in combination, were analyzed using qRT-PCR and Western blotting. Results Injection of Rab10-overexpressing AVV vector into the lateral ventricle significantly improved depressive behaviors of CUMS rats. The mRNA and proteins expression of Rab10 were significantly down-regulated in the hippocampus of CUMS rats and in corticosterone-stimulated PC12 cells. Bioinformatics analysis and the results of double luciferase and RIP experiments confirmed the targeting relationship between miRNA-103-3p and Rab10. In PC12 cells, overexpression of Rab10 or silencing miRNA-103-3p activated the Wnt/β-catenin signaling pathway, up-regulated the expressions of BDNF, CREB and Beclin-1, and down-regulated the expression of p62 protein; silencing Rab10 obviously blocked the effect of miRNA-103-3p inhibitor. Conclusion In mouse models of depression, miRNA-103-3p activates Wnt/β-catenin signaling via targeting rab10 to improve neural plasticity and promotes neural cell autophagy.

Key words: Rab10, miRNA-103-3p, neural plasticity, autophagy, depression

Yeming ZHANG, Yuanxiang ZHANG, Xuebin SHEN, Guodong WANG, Lei ZHU. MiRNA-103-3p promotes neural cell autophagy by activating Wnt/β-catenin signaling via targeting rab10 in a rat model of depression[J]. Journal of Southern Medical University, 2024, 44(7): 1315-1326.

Figures/Tables 11

Fig.1 Grouping and flow chart of the animal experiment.

Tab.1 Primer sequences for qRT-PCR

Gene	Primer sequence (5'-3')
Rab10	F: GCTGAAGACATCCTCCGAAAGACC
Rab10	R: CCGTCACGCCTCCTCCACTG
miRNA-103-3p	F: GAGCAGCATTGTACAG
miRNA-103-3p	R: GTGCAGGGTCCGAGGT
GAPDH	F: ACAACTTTGGTATCGTGGAAGG
GAPDH	R: GCCATCACGCCACAGTTTC
U6	F: GCTTCGGCAGCACATATACTAAAAT
U6	R: CGCTTCACGAATTTGCGTGTCAT

Fig.2 Behavioral changes of rats after 6 weeks of CUMS stimulation. A: Changes of body weight of rats during CUMS. B: Effect of CUMS on total distance of the rats in open field test. C: Effect of CUMS on rearing times of the rats in open field test. D: Effect of CUMS on the number of zone crossing in open field experiment. E: Effect of CUMS on sucrose preference in each group. F: Effect of CUMS on immovability time during forced swimming test. *P<0.05 vs Control.

Fig.3 Overexpression of Rab10 attenuates CUMS-induced depression-like behaviors in rats. A: Changes of body weight of the rats after overexpression of Rab10. B: Changes of total distance of the rats in open field test after overexpression of Rab10. C: Changes of rearing times in open field test after Rab10 overexpression. D: Changes of the number of zone crossing in open field experiment after Rab10 overexpression. E: Changes of sucrose preference in rats after Rab10 overexpression. F: Changes of immovability time of the rats after Rab10 overexpression. *P<0.05 vs. sham; #P<0.05 vs CUMS+AAV-NC.

Fig.4 Expression of Rab10 in PC12 cells after CORT stimulation and in the hippocampus of CUMS mice. A: Detection of Rab10 expression in rat hippocampus by qRT-PCR. B: Protein levels of Rab10 in the hippocampus detected using Western blotting. C: Relative Rab10 protein expression levels. D: CCK-8 experiment for determining optimal concentration of CORT. E: qRT-PCR for detecting the expression of Rab10 in PC12 cells stimulated by CORT. F, G: Protein levels of Rab10 in the cells detected using Western blotting. H, I: Protein levels of Rab10 in PC12 cells detected using Western blotting. *P<0.05 vs Sham, Control, CORT+oe-NC; #P<0.05 vs CUMS+AAV.

Fig.5 Detection of neuroplasticity and autophagy-related proteins in PC12 cells by Western blotting. A: Protein levels of BDNF, CREB, P62 and Beclin-1 in PC12 cells detected using Western blotting. B-E: Relative protein expression levels of BDNF (B), CREB (C), P62 (D), and Beclin-1 (E). *P<0.05 vs Control; #P<0.05 vs CORT+oe-NC.

Fig.6 Western blotting for assessing the effect of Rab10 overexpression on Wnt/β-catenin signaling pathway. A: Protein levels of Wnt3a, GSK3β, p-GSK3β and β-catenin in PC12 cells detected using Western blotting. B-D: Relative protein expression levels of Wnt3a, p-GSK3β/GSK3β and β-catenin, respectively. *P<0.05 vs Control; #P<0.05 vs CORT+oe-NC.

Fig.7 Verification of the interaction between miRNA-103-3p and Rab10. A: TargetScan database showing the binding site of miRNA-103-3p for targeting Rab10. B: qRT-PCR for verifying the expression of miRNA-103-3p in the hippocampus of CUMS mice. C,D: Double luciferase reporter gene experiment confirms the interaction between miRNA-103-3p and Rab10. E: Interaction between miRNA-103-3p and Rab10 detected by Ago2 RIP experiment. *P<0.05 vs Control, miR-NC, anti-NC.

Fig.8 Effect of miRNA-103-3p on Rab10 expression level. A: qRT-PCR for detecting miRNA-103-3p expression in PC12 cells induced by CORT. B: qRT-PCR for verifying interference efficiency of miRNA-103-3p in PC12 cells induced by CORT. C, D: Protein levels of Rab10 in the PC12 cells detected using Western blotting. E, F: Protein levels of Rab10 in PC12 cells with Rab10 knockdown detected using Western blotting. *P<0.05 vs Control, CORT+sh-NC; #P<0.05 vs CORT +inhibitor-NC.

Fig.9 Effects of miRNA-103-3p-mediated Rab10 regulation on neuroplasticity and autophagy-related protein expression in PC12 cells detected by Western blotting. A: Protein levels of BDNF, CREB, P62 and Beclin-1 in PC12 cells detected using Western blotting. B-E: Relative protein expression levels of BDNF, CREB, P62 and Beclin-1, respectively. *P<0.05 vs Control; #P<0.05 vs CORT+inhibitor-NC; &P<0.05 vs CORT+miRNA-103-3p inhibitor+sh-NC.

Fig.10 Western blotting for analyzing the effect of miRNA-103-3p on expressions of Wnt/β-catenin signaling pathway-related proteins in PC12 cells. A: Protein levels of Wnt3a, GSK3β, p-GSK3β and β-catenin in the cells detected using Western blotting. B-D: Relative protein expression levels of Wnt3a, GSK3β, p-GSK3β and β-catenin, respectively. *P<0.05 vs Control; #P<0.05 vs CORT+inhibitor-NC; &P<0.05 vs CORT+miRNA-103-3p inhibitor+sh-NC.

References 34

1	Noetel M, Sanders T, Gallardo-Gómez D, et al. Effect of exercise for depression: systematic review and network meta-analysis of randomised controlled trials[J]. BMJ, 2024, 384: e075847.
2	Steffens DC. Treatment-resistant depression in older adults[J]. N Engl J Med, 2024, 390(7): 630-9.
3	Zhang K, Wang F, Zhai MY, et al. Hyperactive neuronal autophagy depletes BDNF and impairs adult hippocampal neurogenesis in a corticosterone-induced mouse model of depression[J]. Theranostics, 2023, 13(3): 1059-75.
4	Kallergi E, Daskalaki AD, Kolaxi A, et al. Dendritic autophagy degrades postsynaptic proteins and is required for long-term synaptic depression in mice[J]. Nat Commun, 2022, 13(1): 680.
5	Abdulghani A, Poghosyan M, Mehren A, et al. Neuroplasticity to autophagy cross-talk in a therapeutic effect of physical exercises and irisin in ADHD[J]. Front Mol Neurosci, 2022, 15: 997054.
6	Hwang JY, Yan J, Zukin RS. Autophagy and synaptic plasticity: epigenetic regulation[J]. Curr Opin Neurobiol, 2019, 59: 207-12.
7	Fleming A, Rubinsztein DC. Autophagy in neuronal development and plasticity[J]. Trends Neurosci, 2020, 43(10): 767-79.
8	Jaldin-Fincati JR, Pavarotti M, Frendo-Cumbo S, et al. Update on GLUT4 vesicle traffic: a cornerstone of insulin action[J]. Trends Endocrinol Metab, 2017, 28(8): 597-611.
9	Tavana JP, Rosene M, Jensen NO, et al. RAB10: an Alzheimer's disease resilience locus and potential drug target[J]. Clin Interv Aging, 2019, 14: 73-9.
10	Vieira OV. Rab3a and Rab10 are regulators of lysosome exocytosis and plasma membrane repair[J]. Small GTPases, 2018, 9(4): 349-51.
11	Lu TX, Rothenberg ME. MicroRNA[J]. J Allergy Clin Immunol, 2018, 141(4): 1202-7.
12	Wang LM, Zhao Y, Gang SC, et al. Inhibition of miR-103-3p preserves neurovascular integrity through caveolin-1 in experimental subarachnoid hemorrhage[J]. Neuroscience, 2021, 461: 91-101.
13	Li W, Wang SS, Shan BQ, et al. MiR-103-3p targets Ndel1 to regulate neural stem cell proliferation and differentiation[J]. Neural Regen Res, 2022, 17(2): 401-8.
14	Als TD, Kurki MI, Grove J, et al. Depression pathophysiology, risk prediction of recurrence and comorbid psychiatric disorders using genome-wide analyses[J]. Nat Med, 2023, 29(7): 1832-44.
15	童九翠. 豆腐果苷抗抑郁作用的分子机制研究[D]. 芜湖: 安徽师范大学, 2019.
16	Singh V, Menard MA, Serrano GE, et al. Cellular and subcellular localization of Rab10 and phospho-T73 Rab10 in the mouse and human brain[J]. Acta Neuropathol Commun, 2023, 11(1): 201.
17	Zhang YX, Zhang XT, Li HJ, et al. Antidepressant-like effects of helicid on a chronic unpredictable mild stress-induced depression rat model: Inhibiting the IKK/IκBα/NF-κB pathway through NCALD to reduce inflammation[J]. Int Immunopharmacol, 2021, 93: 107165.
18	Lages YVM, Rossi AD, Krahe TE, et al. Effect of chronic unpredictable mild stress on the expression profile of serotonin receptors in rats and mice: a meta-analysis[J]. Neurosci Biobehav Rev, 2021, 124: 78-88.
19	Markov DD, Novosadova EV. Chronic unpredictable mild stress model of depression: possible sources of poor reproducibility and latent variables[J]. Biology, 2022, 11(11): 1621.
20	Markov DD. Sucrose preference test as a measure of anhedonic behavior in a chronic unpredictable mild stress model of depression: outstanding issues[J]. Brain Sci, 2022, 12(10): 1287.
21	Lin RH, Liu LL, Silva M, et al. Hederagenin protects PC12 cells against corticosterone-induced injury by the activation of the PI3K/AKT pathway[J]. Front Pharmacol, 2021, 12: 712876.
22	Chai YH, Cai YW, Fu Y, et al. Salidroside ameliorates depression by suppressing NLRP3-mediated pyroptosis via P2X7/NF-κB/NLRP3 signaling pathway[J]. Front Pharmacol, 2022, 13: 812362.
23	Yan TX, Wang LW, Gao J, et al. Rab10 phosphorylation is a prominent pathological feature in Alzheimer's disease[J]. J Alzheimers Dis, 2018, 63(1): 157-65.
24	Price RB, Duman R. Neuroplasticity in cognitive and psychological mechanisms of depression: an integrative model[J]. Mol Psychiatry, 2020, 25: 530-43.
25	Tartt AN, Mariani MB, Hen RE, et al. Dysregulation of adult hippocampal neuroplasticity in major depression: pathogenesis and therapeutic implications[J]. Mol Psychiatry, 2022, 27(6): 2689-99.
26	Colucci-D'Amato L, Speranza L, Volpicelli F. Neurotrophic factor BDNF, physiological functions and therapeutic potential in depression, neurodegeneration and brain cancer[J]. Int J Mol Sci, 2020, 21(20): 7777.
27	Björkholm C, Monteggia LM. BDNF-a key transducer of antidepressant effects[J]. Neuropharmacology, 2016, 102: 72-9.
28	Tang MM, Liu T, Jiang P, et al. The interaction between autophagy and neuroinflammation in major depressive disorder: from pathophysiology to therapeutic implications[J]. Pharmacol Res, 2021, 168: 105586.
29	Jung S, Choe S, Woo H, et al. Autophagic death of neural stem cells mediates chronic stress-induced decline of adult hippocampal neurogenesis and cognitive deficits[J]. Autophagy, 2020, 16(3): 512-30.
30	Rein T. Is autophagy involved in the diverse effects of antidepressants[J]? Cells, 2019, 8(1): 44.
31	Reya T, Clevers H. Wnt signalling in stem cells and cancer[J]. Nature, 2005, 434(7035): 843-50.
32	Ji RR, Xu ZZ, Gao YJ. Emerging targets in neuroinflammation-driven chronic pain[J]. Nat Rev Drug Discov, 2014, 13: 533-48.
33	Lorzadeh S, Kohan L, Ghavami S, et al. Autophagy and the Wnt signaling pathway: a focus on Wnt/β-catenin signaling[J]. Biochim Biophys Acta Mol Cell Res, 2021, 1868(3): 118926.
34	Narvaes RF, Furini CRG. Role of Wnt signaling in synaptic plasticity and memory[J]. Neurobiol Learn Mem, 2022, 187: 107558.

[1]	Weiyi LI, Lu JIANG, Zongxing ZHANG, Dan CHEN, Zhuoma BAO, Li HUANG, Lin YUAN. Qianggu Kangshu Formula attenuates osteoclast differentiation in rheumatoid arthritis by inhibiting the HIF-1α/BNIP3 autophagy signaling pathway [J]. Journal of Southern Medical University, 2025, 45(7): 1389-1396.
[2]	Xinheng WANG, Xiaohan SHAO, Tongtong LI, Lu ZHANG, Qinjun YANG, Weidong YE, Jiabing TONG, Zegeng LI, Xiangming FANG. Pingchuanning Formula suppresses airway inflammation in a rat model of asthmatic cold syndrome by regulating the HMGB1/Beclin-1 axis-mediated autophagy [J]. Journal of Southern Medical University, 2025, 45(6): 1153-1162.
[3]	Xia LV, Rong XIAO. Materialistic values and their association with depression in medical postgraduates: materialism leads to higher risk of depression [J]. Journal of Southern Medical University, 2025, 45(6): 1220-1225.
[4]	Meimei CHEN, Yang WANG, Huangwei LEI, Fei ZHANG, Ruina HUANG, Zhaoyang YANG. Construction of recognition models for subthreshold depression based on multiple machine learning algorithms and vocal emotional characteristics [J]. Journal of Southern Medical University, 2025, 45(4): 711-717.
[5]	Yanyan DONG, Kejing ZHANG, Jun CHU, Quangen CHU. Didang Decoction-medicated serum enhances autophagy in high glucose-induced rat glomerular endothelial cells via the PI3K/Akt/mTOR signaling pathway [J]. Journal of Southern Medical University, 2025, 45(3): 461-469.
[6]	Zhengtao GAO, Pingyan LIN, Bingcan ZHOU, Mingheng CHEN, Erqi LIU, Tianxiang LEI, Huixin NI, Haixin LIU, Yao LIN, Qian XU. Hypericin ameliorates stress-induced depressive-like behaviors in mice by modulating the CN-NFAT calcium signaling pathway in microglia [J]. Journal of Southern Medical University, 2025, 45(3): 506-513.
[7]	Ming LIAO, Wenhua ZHONG, Ran ZHANG, Juan LIANG, Wentaorui XU, Wenjun WAN, Chao LI Shu WU. Protein C activator derived from snake venom protects human umbilical vein endothelial cells against hypoxia-reoxygenation injury by suppressing ROS via upregulating HIF-1α and BNIP3 [J]. Journal of Southern Medical University, 2025, 45(3): 614-621.
[8]	Ying LIU, Borui LI, Yongcai LI, Lubo CHANG, Jiao WANG, Lin YANG, Yonggang YAN, Kai QV, Jiping LIU, Gang ZHANG, Xia SHEN. Jiawei Xiaoyao Pills improves depression-like behavior in rats by regulating neurotransmitters, inhibiting inflammation and oxidation and modulating intestinal flora [J]. Journal of Southern Medical University, 2025, 45(2): 347-358.
[9]	Kelei GUO, Yingli LI, Chenguang XUAN, Zijun HOU, Songshan YE, Linyun LI, Liping CHEN, Li HAN, Hua BIAN. Yiqi Yangyin Huazhuo Tongluo Formula alleviates diabetic podocyte injury by regulating miR-21a-5p/FoxO1/PINK1-mediated mitochondrial autophagy [J]. Journal of Southern Medical University, 2025, 45(1): 27-34.
[10]	Junping ZHAN, Shuo HUANG, Qingliang MENG, Wei FAN, Huimin GU, Jiakang CUI, Huilian WANG. Buyang Huanwu Decoction reduces mitochondrial autophagy in rheumatoid arthritis synovial fibroblasts in hypoxic culture by inhibiting the BNIP3-PI3K/Akt pathway [J]. Journal of Southern Medical University, 2025, 45(1): 35-42.
[11]	Zhiliang CHEN, Yonggang YANG, Xia HUANG, Yan CHENG, Yuan QU, Qiqi HENG, Yujia FU, Kewei LI, Ning GU. Differential expressions of exosomal miRNAs in patients with chronic heart failure and hyperuricemia: diagnostic values of miR-27a-5p and miR-139-3p [J]. Journal of Southern Medical University, 2025, 45(1): 43-51.
[12]	Mingzi OUYANG, Jiaqi CUI, Hui WANG, Zheng LIANG, Dajin PI, Liguo CHEN, Qianjun CHEN, Yingchao WU. Kaixinsan alleviates adriamycin-induced depression-like behaviors in mice by reducing ferroptosis in the prefrontal cortex [J]. Journal of Southern Medical University, 2024, 44(8): 1441-1449.
[13]	Yao CHENG, Yuanying WANG, Feiyang YAO, Pan HU, Mingxian CHEN, Ning WU. Baicalin suppresses type 2 dengue virus-induced autophagy of human umbilical vein endothelial cells by inhibiting the PI3K/AKT pathway [J]. Journal of Southern Medical University, 2024, 44(7): 1272-1283.
[14]	Qianyi CHEN, Shuhan SHANG, Huan LU, Sisi LI, Zhimian SUN, Xirui FAN, Zhilin QI. Calenduloside E inhibits hepatocellular carcinoma cell proliferation and migration by down-regulating GPX4 and SLC7A11 expression through the autophagy pathway [J]. Journal of Southern Medical University, 2024, 44(7): 1327-1335.
[15]	Yiming SUN, Rong ZHANG, Ying MENG, Lei ZHU, Mingqiang LI, Zhe LIU. Coenzyme Q10 alleviates depression-like behaviors in mice with chronic restraint stress by down-regulating the pyroptosis signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 810-817.