Aerobic exercise improves metabolic disorders and multi-organ damage in diabetic rats by activating the Sirt1/Creb1/Ppargc1a axis

doi:10.12122/j.issn.1673-4254.2026.10.17

Abstract

Abstract:

Objective To investigate the effects of aerobic exercise and exhaustive anaerobic exercise on organ glucose metabolism and function in type 2 diabetic rats and the underlying mechanisms. Methods Forty male SD rats were randomly divided into normal control group (n=10) and diabetic model group (n=30). In the latter group, type 2 diabetes was induced by high-fat and high-sugar diet combined with streptozotocin injection. The diabetic rat models were further assigned to diabetic control, aerobic exercise and exhaustive anaerobic exercise groups (n=10) with an 8-week exercise intervention. General physiological indicators of the rats were measured, and liver, quadriceps, heart and prefrontal cortex tissues were collected for HE, Masson, PAS staining and immunohistochemistry. Hepatic expression of key metabolic enzymes and genes were detected using Western blotting and qPCR. Results Compared with the normal control rats, the diabetic rats had significantly increased body weight, liver index, fasting blood glucose and serum levels of metabolic markers with severe hepatic steatosis, fibrosis, glycogen loss, skeletal and cardiac muscle damages, and downregulated DRD1/DRD5, 5-HT and TH in the prefrontal cortex. Aerobic exercise markedly reversed these abnormalities, alleviated organ pathological lesions, suppressed hepatic G6PC and glycolytic enzymes, upregulated Sirt1 mRNA, and restored cortical neurotransmitter-related proteins in the diabetic rats. Exhaustive anaerobic exercise lowered body weight and fasting glucose of the diabetic rats, but caused significant increase of serum metabolic indicators, worsened hepatic steatosis and tissue fibrosis, reduced glycogen, and further reduction of neurotransmitter expressions in the brain. Conclusion Aerobic exercise protects organ function of diabetic rats by regulating glucose-lipid metabolism, relieving inflammation and fibrosis and improving neurotransmitter function, while exhaustive anaerobic exercise can aggravate metabolic disorders and cause tissue damage.

Key words: aerobic exercise, anaerobic exhaustive exercise, type 2 diabetes, glucose metabolism, multiple organ functions

Guannan ZHANG, Xiang LI, Yuan MI, Danyang TIAN, Jinqi MENG. Aerobic exercise improves metabolic disorders and multi-organ damage in diabetic rats by activating the Sirt1/Creb1/Ppargc1a axis[J]. Journal of Southern Medical University, 2026, 46(10): 2482-2493.

Figures/Tables 11

Tab.1 Primer sequences for qPCR of the target genes

Primer	Sequence
Rat-Btubulin-F1	TAGCAGCGTTGCTGGGTATC
Rat-Btubulin-R1	GACTGGAATGCCTCGCTCTT
Rat-Sirt1-F1	TCAGAACCACCAAAGCGGAA
Rat-Sirt1-R1	GCAAGGCGAGCATAAATACCA
Rat-Creb1-F1	TCCTCCCCAGCACTTCCTAC
Rat-Creb1-R1	CCAATCCAGTCCATTTTCCA
Rat-Ppargc1a-F2	AACAGAAACAGCAGCAGAGACAA
Rat-Ppargc1a-R2	GCAGTTCCAGAGAGTTCCACAC

Tab.2 Changes in body weight, liver wet weight, and liver index of the rats in each group (Mean±SD, n=10)

Variables	Blank control group	Diabetes control group	Diabetes aerobic group	Diabetes exhaustion group
Weight (g)	328.90±10.73	379.50±11.88**	350.10±12.68^##	296.60±14.16^##
Liver wet weight (g)	14.22±1.52	26.49±2.64**	19.26±2.49^##	29.60±3.12^#
Liver index (%)	4.33±0.51	6.99±0.75**	5.50±0.64^##	9.97±0.78^##

Tab. 3 Changes in fasting blood glucose, blood lactate, pyruvate, creatinine, blood urea nitrogen， and creatine kinase levels in each group of the rats (Mean±SD, n=10)

Variables	Blank control group	Diabetes control group	Diabetes aerobic group	Diabetes exhaustion group
FBG (mmol/L)	6.24±0.72	13.09±1.06**	8.11±0.85^##	10.29±0.72^##
Lactic acid (mmol/L)	2.55±0.39	3.97±0.50**	3.05±0.46^##	6.46±0.65^##
Pyruvic acid (mmol/L)	0.42±0.05	0.82±0.11**	0.61±0.10^##	1.11±0.17^##
Creatinine (mg/dL)	0.61±0.08	1.55±0.16**	0.82±0.13^##	2.35±0.27^##
Urea nitrogen (mmol/L)	3.70±0.28	6.19±0.98**	4.73±0.65^##	7.46±0.97^#
Creatine kinase (U/L)	115.70±24.00	305.30±30.42**	191.30±24.41^##	508.90±58.60^##

Fig.1 Histopathological changes in skeletal muscles of the rats in each group. A: HE staining, Masson staining, and PAS staining of mouse skeletal muscle tissues (Scale bar=100 μm). B: Collagen volume fraction of the rats in each group. C: Percentage of PAS-positive area in each group of rats. Data are presented as Mean±SD (n=10). a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group. Arrows indicate damaged muscle fibers, inflammatory cell infiltration, and vacuolar degeneration. **P<0.01 vs blank control group; ##P<0.01 vs the diabetes control group.

Fig.2 HE staining of myocardial tissue from rats in each group (Scale bar=100 μm). a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group. Arrows indicate disordered and ruptured myocardial fibers, widened intercellular spaces, and necrotic areas.

Fig.3 Expression distribution of DRD1, DRD5, 5-HT, and TH in the prefrontal cortex of rats in each group (Scale bar=100 μm. a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group.

Fig.4 Average optical density of DRD1 (A), DRD5 (B), 5-HT (C) and TH (D) in the prefrontal cortex of the rats in each group (Mean±SD, n=10). **P<0.01 vs the blank control group; #P<0.05, ##P<0.01 vs the diabetes control group. a. Blank control group; b. Diabetes control group; c. Diabetes aerobic group; d. Diabetes exhaustive group.

Fig.5 Protein expressions of G6PC, PFK, GAPDH and PKM1 in liver tissues of the rats in each group. A: Protein expression levels of G6PC and PFK detected by Western blotting. B: Protein expression levels of GAPDH and PKM1 detected by Western blotting. C: Expression levels of G6PC and PFK in the liver tissues of different groups. D: Expression levels of GAPDH and PKM1 in liver tissues of different groups. Data are presented as Mean±SD (n=10). *P<0.05, **P<0.01 vs the blank control group; ##P<0.01 vs the diabetes control group. a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group.

Fig.6 Protein expression of LDH, SDHA and PCB in liver tissues of rats in each group. A: Detection of protein expression levels of LDH and SDHA by Western blotting. B: Detection of protein expression levels of PCB by Western blotting. C: Expression levels of SDHA, LDH and PCB in liver tissues of different groups (Mean±SD, n=10).*P<0.05, **P<0.01 vs blank control group; ##P<0.01 vs the diabetes control group. a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group.

Fig.7 HE, Masson, and PAS staining (A) of liver tissues, collagen volume fraction (B) and percentage of PAS-positive area in each group (Scale bar=100 μm). Data are presented as Mean±SD (n=10). a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group. Arrows indicate lipid vacuoles of varying sizes and inflammatory cell infiltration in hepatocytes. **P<0.01 vs blank control group; ##P<0.01 vs the diabetes control group.

Fig.8 Changes in mRNA expression of Sirt1, Creb1, and Ppargc1a in the livers of rats in each group (Mean±SD, n=10).*P<0.05, **P<0.01 vs the blank control group; ##P<0.01 vs the diabetes control group. a: Blank control group; b: Diabetes control group; c: Diabetes aerobic group; d: Diabetes exhaustive group.

References 40

[1]	Risk Factor CollaborationNCD. Worldwide trends in diabetes prevalence and treatment from 1990 to 2022: a pooled analysis of 1108 population-representative studies with 141 million participants[J]. Lancet, 2024, 404(10467): 2077-93.
[2]	Cao R, Tian HM, Zhang Y, et al. Signaling pathways and intervention for therapy of type 2 diabetes mellitus[J]. MedComm, 2023, 4(3): e283. doi：10.1002/mco2.283
[3]	Zhou Z, Sun B, Yu DS, et al. Gut microbiota: an important player in type 2 diabetes mellitus[J]. Front Cell Infect Microbiol, 2022, 12: 834485. doi：10.3389/fcimb.2022.834485
[4]	Dutta BJ, Singh S, Seksaria S, et al. Inside the diabetic brain: Insulin resistance and molecular mechanism associated with cognitive impairment and its possible therapeutic strategies[J]. Pharmacol Res, 2022, 182: 106358. doi：10.1016/j.phrs.2022.106358
[5]	Liu RJ, Shi XF, Zhang X. The effects of resistance training on glycemic control, cardiometabolic health, and body composition in middle-aged and older women with type 2 diabetes and overweight or obesity: a systematic review and meta-analysis[J]. Maturitas, 2025, 201: 108691. doi：10.1016/j.maturitas.2025.108691
[6]	Mohd S, Kumar LL, Harish V, et al. Diabetes mellitus: Complications, emerging therapeutic targets, and evolving treatment approaches[J]. Obes Med, 2025, 58: 100652. doi：10.1016/j.obmed.2025.100652
[7]	Xing HM, Lu JH, Yoong SQ, et al. Effect of aerobic and resistant exercise intervention on inflammaging of type 2 diabetes mellitus in middle-aged and older adults: a systematic review and meta-analysis[J]. J Am Med Dir Assoc, 2022, 23(5): 823-30.e13. doi：10.1016/j.jamda.2022.01.055
[8]	Zhao RX, Li JY, Du FB, et al. Effects of long-term moderate-intensity exercise on autonomic nervous system dysfunction induced by cardiac neurovascular interface deterioration[J]. Rev Cardiovasc Med, 2025, 26(10): 40714. doi：10.31083/rcm40714
[9]	Gao HY, Zhao YL, Zhao LL, et al. The role of oxidative stress in multiple exercise-regulated bone homeostasis[J]. Aging Dis, 2023, 14(5): 1555-82. doi：10.14336/ad.2023.0223
[10]	Amar D, Gay NR, Jimenez-Morales D, et al. The mitochondrial multi-omic response to exercise training across rat tissues[J]. Cell Metab, 2024, 36(6): 1411-29.e10.
[11]	Araki E, Goto A, Kondo T, et al. Japanese clinical practice guideline for diabetes 2019[J]. Diabetol Int, 2020, 11(3): 165-223. doi：10.1007/s13340-020-00439-5
[12]	Sheikh R, Shakerian S, Fatemi Tabatabaei SR, et al. Moderate and high-intensity interval training protect against diabetes-induced modulation of hepatic CD86 and CD206 expression associated with the amelioration of insulin resistance and inflammation in rats[J]. Immunobiology, 2023, 228(6): 152745. doi：10.1016/j.imbio.2023.152745
[13]	Yap KH, Yee GS, Candasamy M, et al. Catalpol ameliorates insulin sensitivity and mitochondrial respiration in skeletal muscle of type-2 diabetic mice through insulin signaling pathway and AMPK/SIRT1/PGC-1α/PPAR-γ activation[J]. Biomolecules, 2020, 10(10): 1360. doi：10.3390/biom10101360
[14]	Ma XT, Gao HY, Wang Z, et al. Beneficial effects of different types of exercise on diabetic cardiomyopathy[J]. Biomolecules, 2025, 15(9): 1223. doi：10.3390/biom15091223
[15]	Wang GD. Aerobic exercise ameliorates myocardial ischemia/reperfusion injury and thrombosis of diabetic rats via activation of AMPK/Sirt1/PGC-1α pathway[J]. Gen Physiol Biophys, 2022, 41(4): 319-28. doi：10.4149/gpb_2022010
[16]	Zheng LF, Qin RT, Rao ZJ, et al. High-intensity interval training induces renal injury and fibrosis in type 2 diabetic mice[J]. Life Sci, 2023, 324: 121740. doi：10.1016/j.lfs.2023.121740
[17]	Sahin AM, Sonmez OF, et al. Effects of acute exhaustive exercise on oxidant and antioxidant system parameters in rats with streptozotocin induced diabetes mellitus[J]. TurkJSportsMed, 2020, 55(2): 131-7. doi：10.5152/tjsm.2020.169
[18]	Tan LS, Lau HH, Abdelalim EM, et al. The role of glucose-6-phosphatase activity in glucose homeostasis and its potential for diabetes therapy[J]. Trends Mol Med, 2025, 31(2): 152-64. doi：10.1016/j.molmed.2024.09.005
[19]	Luu L, Dai FF, Prentice KJ, et al. The loss of Sirt1 in mouse pancreatic beta cells impairs insulin secretion by disrupting glucose sensing[J]. Diabetologia, 2013, 56(9): 2010-20. doi：10.1007/s00125-013-2946-5
[20]	Yu Y, Zhao Y, Teng F, et al. Berberine improves cognitive deficiency and muscular dysfunction via activation of the AMPK/SIRT1/PGC-1a pathway in skeletal muscle from naturally aging rats[J]. J Nutr Health Aging, 2018, 22(6): 710-7. doi：10.1007/s12603-018-1015-7
[21]	Chen C, Zhou M, Ge YC, et al. SIRT1 and aging related signaling pathways[J]. Mech Ageing Dev, 2020, 187: 111215. doi：10.1016/j.mad.2020.111215
[22]	Shen YH, Mao ZJ, Chen HM, et al. Exercise-specific post-translational modification signatures: unveiling precise regulatory mechanisms of molecular exercise language and cellular adaptation[J]. Front Sports Act Living, 2026, 8: 1765170. doi：10.3389/fspor.2026.1765170
[23]	Rodrigues B, Figueroa DM, Mostarda CT, et al. Maximal exercise test is a useful method for physical capacity and oxygen consumption determination in streptozotocin-diabetic rats[J]. Cardiovasc Diabetol, 2007, 6: 38. doi：10.1186/1475-2840-6-38
[24]	Qin F, Dong YN, Wang ST, et al. Maximum oxygen consumption and quantification of exercise intensity in untrained male Wistar rats[J]. Sci Rep, 2020, 10: 11520. doi：10.1038/s41598-020-68455-8
[25]	Arifin WN, Zahiruddin WM. Sample size calculation in animal studies using resource equation approach[J]. Malays J Med Sci, 2017, 24(5): 101-5. doi：10.21315/mjms2017.24.5.11
[26]	Charan J, Kantharia ND. How to calculate sample size in animal studies?[J]. J Pharmacol Pharmacother, 2013, 4(4): 303-6. doi：10.4103/0976-500x.119726
[27]	Gao HY, Ma XT, Wang Z, et al. The effects of different types of exercise on pulmonary inflammation and fibrosis in mice with type 2 diabetes mellitus[J]. Cells, 2025, 14(13): 1026. doi：10.3390/cells14131026
[28]	Tomiga Y, Tanaka K, Kusuyama J, et al. Exercise training ameliorates carbon tetrachloride-induced liver fibrosis and anxiety-like behaviors[J]. Am J Physiol Gastrointest Liver Physiol, 2024, 327(6): G850-60. doi：10.1152/ajpgi.00161.2024
[29]	Festing MF. On determining sample size in experiments involving laboratory animals[J]. Lab Anim, 2018, 52(4): 341-50. doi：10.1177/0023677217738268
[30]	Yu Y, Xu LS, Wu Y, et al. The antihypertensive effect of MK on spontaneously hypertensive rats through the AMPK/Akt/ENOS/NO and ERK1/2/Cx43 signaling pathways[J]. Hypertens Res, 2021, 44(7): 781-90. doi：10.1038/s41440-021-00638-w
[31]	Bortolon JR, Murata GM, Borges L, et al. Recovery of diabetic rats after physical exhaustion: kinetic alterations in muscle inflammation and muscle-signaling proteins to atrophy and hypertrophy[J]. Front Physiol, 2020, 11: 573416. doi：10.3389/fphys.2020.573416
[32]	Oka SI, Byun J, Huang CY, et al. Nampt potentiates antioxidant defense in diabetic cardiomyopathy[J]. Circ Res, 2021, 129(1): 114-30. doi：10.1161/circresaha.120.317943
[33]	Wang SY, Zhu SY, Wu J, et al. Exercise enhances cardiac function by improving mitochondrial dysfunction and maintaining energy homoeostasis in the development of diabetic cardiomyopathy[J]. J Mol Med, 2020, 98(2): 245-61. doi：10.1007/s00109-019-01861-2
[34]	De Sousa RAL, Improta-Caria AC, de Freitas Souza BS. Exercise–linked irisin: consequences on mental and cardiovascular health in type 2 diabetes[J]. Int J Mol Sci, 2021, 22(4): 2199. doi：10.3390/ijms22042199
[35]	Al-Sayyar A, Hammad MM, Williams MR, et al. Neurotransmitters in type 2 diabetes and the control of systemic and central energy balance[J]. Metabolites, 2023, 13(3): 384. doi：10.3390/metabo13030384
[36]	Hajiluian G, Abbasalizad Farhangi M, Nameni G, et al. Oxidative stress-induced cognitive impairment in obesity can be reversed by vitamin D administration in rats[J]. Nutr Neurosci, 2018, 21(10): 744-52. doi：10.1080/1028415x.2017.1348436
[37]	He HJ, Zhong Y, Wang HL, et al. Smad3 mediates diabetic dyslipidemia and fatty liver in db/db mice by targeting PPARδ[J]. Int J Mol Sci, 2023, 24(14): 11396. doi：10.3390/ijms241411396
[38]	Adam SY, Eltahir HA, Mohammed Ismaeel FA, et al. Gum Arabic regulates glucose metabolic enzymes through modification of hepatic phosphoenolpyruvate carboxykinase expression in diabetic rats[J]. Bioact Carbohydr Diet Fibre, 2025, 34: 100490. doi：10.1016/j.bcdf.2025.100490
[39]	He LN, Li Y, Zeng N, et al. Regulation of basal expression of hepatic PEPCK and G6Pase by AKT2[J]. Biochem J, 2020, 477(5): 1021-31. doi：10.1042/bcj20190570
[40]	Pietrowska-Borek M, Dobrogojski J, Sobieszczuk-Nowicka E, et al. New insight into plant signaling: extracellular ATP and uncommon nucleotides[J]. Cells, 2020, 9(2): 345. doi：10.3390/cells9020345