circ_EPHB4 synergizes with YTHDF3 to promote glioma progression via m6A-dependent stabilization of Wnt3

doi:10.12122/j.issn.1673-4254.2025.11.04

Abstract

Abstract:

Objective To investigate the oncogenic role of circular RNA circ_EPHB4 in glioma and its molecular mechanism. Methods Microarray analysis was performed to identify the differentially expressed circRNAs in glioma tissues. The effects of circ_EPHB4 on glioma cell migration, invasion and epithelial-mesenchymal transition (EMT) in vitro and tumorigenicity in vivo were assessed using scratch wound healing assay, Transwell invasion assay and nude mouse models bearing subcutaneous tumors. RNA immunoprecipitation (RIP), RNA stability assays, and gene overexpression and silencing techniques were employed to validate the synergistic regulatory effect of circ_EPHB4 and the N6-methyladenosine (m⁶A) reader protein YTHDF3 on Wnt3 expression. Results Circ_EPHB4 was significantly overexpressed by 2.3 folds (|log2FC|=1.2, P<0.01) in glioma tissues compared to the adjacent tissues, and by 2.5 folds in glioma cell line U373 compared to normal cells (P<0.001). Overexpression of circ_EPHB4 significantly enhanced migration and invasion of glioma cells, and promoted the expressions of EMT markers N-cadherin and vimentin. In the tumor-bearing mouse models, the tumor volume in circ_EPHB4 overexpression group was significantly greater than that in the control group, and the lung metastatic foci increased by 4.2 folds. Overexpression of circ_EPHB4 promoted oncogenesis by upregulating Wnt3 expression, while YTHDF3 extended the half-life of Wnt3 mRNA in an m⁶A-dependent manner. Simultaneous knockdown of circ_EPHB4 and YTHDF3 resulted in an obvious reduction of Wnt3 mRNA expression by up to 47% compared to its level following knocking down either circ_EPHB4 or YTHDF3 alone. Conclusion Circ_EPHB4 and YTHDF3 promote glioma progression by jointly targeting the Wnt3 signaling pathway, which may provide a new therapeutic strategy for gliomas.

Key words: circ_EPHB4, m⁶A, YTHDF3, Wnt3, glioma

Chen JIN, Jingping LIU, Bo LIU, Xiyun FEI, Yuxiang LIAO. circ_EPHB4 synergizes with YTHDF3 to promote glioma progression via m⁶A-dependent stabilization of Wnt3[J]. Journal of Southern Medical University, 2025, 45(11): 2320-2329.

Figures/Tables 6

Tab.1 Primer sequences for RT-qPCR of the target and housekeeping genes

Gene	Forward Primer (5'-3')	Reverse Primer (5'-3')
circ_EPHB4	CAGAGAGCGCATCCGCAATTT	AAAGAAGGTGCGCCCACGGTT
Zeb1	AACAGTGAGCGACCTTCATT	AGAGCGCAGAGAAGGAGAGTT
GAPDH	AGAGCGCAGAGAAGGAGAUTT	AAAGAGCGAGAGAAGGAGAT

Fig.2 circ_EPHB4 promotes glioma cell migration, invasion, and EMT. A: qRT-PCR of circ_EPHB4 expression in glioma cells after transfection with circ_EPHB4-overexpressing plasmids or circ_EPHB4 siRNA (**P<0.01). B: Scratch wound healing assay for evaluating glioma cell migration ability following circ_EPHB4 overexpression or knockdown (scale bar=100 μm). C: Transwell invasion assay for assessing glioma cell invasion ability after transfection (scale bar=50 μm). D: Western blotting of EMT-related proteins (E-cadherin, N-cadherin and vimentin) in glioma cells following circ_EPHB4 overexpression or knockdown. Data are presented as Mean±SD from 3 independent experiments. *P<0.05 vs siRNA NC; #P<0.05 vs pcDNA3.1 NC.

Fig3 circ_EPHB4 promotes tumorigenesis and metastasis of glioma cells in nude mice. A: Number of pulmonary metastatic nodules in each group. B: Subcutaneous tumor volume at different time points in each group. C: Subcutaneous tumor weight in each group (*P<0.05, **P<0.01, ***P<0.001). D: qRT-PCR analysis of mRNA expressions of E-cadherin, N-cadherin, vimentin) in subcutaneous tumors. E: Immunohistochemicalanalysis of protein expressions of E-cadherin, N-cadherin, and vimentin in subcutaneous tumors from each group. **P<0.01, ***P<0.001 vs siRNA NC group; ##P<0.01, ### P<0.001 vs pcDNA3.1 NC group.

Fig.4 circ_EPHB4 promotes glioma cell metastasis by upregulating Wnt3 expression. A: Overexpression of circ_EPHB4 enhances Wnt3 expression, and circ_EPHB4 knockdown suppresses Wnt3 expression. B: Scratch wound healing assay for evaluating the effect of Wnt3 knockdown on glioma cell migration following circ_EPHB4 overexpression (scale bar=50 μm). C: Transwell invasion assay for assessing the impact of Wnt3 knockdown on invasion ability of circ_EPHB4-overexpressing glioma cells (scale bar=50 μm). D: Western blotting for evaluating the effects of Wnt3 knockdown on expressions of E-cadherin, N-cadherin and vimentin in circ_EPHB4-overexpressing glioma cells.

Fig.5 YTHDF3 enhances Wnt3 mRNA stability in an m6A-dependent manner. A: Direct interaction between YTHDF3 and Wnt3 mRNA in U3T3 and SHG44 cells. B: Effect of YTHDF3 knockdown on Wnt3 expression. C: Positive correlation between YTHDF3 and Wnt3 expression in the StarBase database. D: Effect of circ_EPHB4 on the interaction between YTHDF3 and Wnt3 RNA. E: Effect of combined knockdown of circ_EPHB4 and YTHDF3 on Wnt3 mRNA expression. *P<0.05, **P<0.01, ***P<0.001.

References 31

[1]	Ludwig K, Kornblum HI. Molecular markers in glioma[J]. J Neurooncol, 2017, 134(3): 505-12. doi：10.1007/s11060-017-2379-y
[2]	翟贝, 魏灯, 王萍. tRNA修饰在胶质瘤中的研究进展[J]. 中国肿瘤临床, 2024,51(11): 567-71.
[3]	贾金曦, 姚春旭, 刘畅, 等. 脑胶质瘤患者术后远期预后影响因素分析[J]. 实用癌症杂志, 2024, 39(3): 514-7.
[4]	Liu ZX, Li LM, Sun HL, et al. Link between m6A modification and cancers[J]. Front Bioeng Biotechnol, 2018, 6: 89. doi：10.3389/fbioe.2018.00089
[5]	Zhang G, Cheng C, Wang X, et al. N6-Methyladenosine methylation modification in breast cancer: current insights[J]. J Transl Med, 2024, 22(1): 971. doi：10.1186/s12967-024-05771-x
[6]	Rui Y, Zhang H, Yu K, et al. N⁶-methyladenosine regulates Cilia elongation in cancer cells by modulating HDAC6 expression[J]. Adv Sci: Weinh, 2025, 12(2): e2408488. doi：10.1002/advs.202408488
[7]	Chen XH, Guo KX, Li J, et al. Regulations of m6A and other RNA modifications and their roles in cancer[J]. Front Med, 2024, 18(4): 622-48. doi：10.1007/s11684-024-1064-8
[8]	Qin L, Zeng X, Qiu X, et al. The role of N6-methyladenosine modification in tumor angiogenesis[J]. Front Oncol, 2024, 14: 1467850. doi：10.3389/fonc.2024.1467850
[9]	Saluja S, Ganguly S, Singh J, et al. Aberrant overexpression of m6A writer and reader genes in pediatric B-Cell Acute Lymphoblastic Leukemia (B-ALL)[J]. Transl Oncol, 2025, 56: 102403. doi：10.1016/j.tranon.2025.102403
[10]	Zhao Y, Feng F, Guo QH, et al. Role of succinate dehydrogenase deficiency and oncometabolites in gastrointestinal stromal tumors[J]. World J Gastroenterol, 2020, 26(34): 5074-89. doi：10.3748/wjg.v26.i34.5074
[11]	Li J, Han Y, Zhang HM, et al. The m6A demethylase FTO promotes the growth of lung cancer cells by regulating the m6A level of USP7 mRNA[J]. Biochem Biophys Res Commun, 2019, 512(3): 479-85. doi：10.1016/j.bbrc.2019.03.093
[12]	Dong J, Zeng Z, Huang Y, et al. Challenges and opportunities for circRNA identification and delivery[J]. Crit Rev Biochem Mol Biol, 2023, 58(1): 19-35. doi：10.1080/10409238.2023.2185764
[13]	Chen X, Lu Y. Circular RNA: biosynthesis in vitro [J]. Front Bioeng Biotechnol, 2021, 9: 787881. doi：10.3389/fbioe.2021.787881
[14]	Patop IL, Kadener S. circRNAs in cancer[J]. Curr Opin Genet Dev, 2018, 48: 121-7. doi：10.1016/j.gde.2017.11.007
[15]	Hanan M, Soreq H, Kadener S. CircRNAs in the brain[J]. RNA Biol, 2017, 14(8): 1028-34. doi：10.1080/15476286.2016.1255398
[16]	Chen M, Wei L, Law CT, et al. RNA N6-methyladenosine methyltransferase-like 3 promotes liver cancer progression through YTHDF2-dependent posttranscriptional silencing of SOCS₂ [J]. Hepatology, 2018, 67(6): 2254-70. doi：10.1002/hep.29683
[17]	Yin J, Ding F, Cheng Z, et al. METTL3-mediated m6A modification of LINC00839 maintains glioma stem cells and radiation resistance by activating Wnt/β-catenin signaling[J]. Cell Death Dis, 2023, 14(7): 417. doi：10.1038/s41419-023-05933-7
[18]	Xiao L, Li X, Mu Z, et al. FTO inhibition enhances the anti-tumor effect of temozolomide by targeting MYC-miR-155/23a cluster-MXI1 feedback circuit in glioma. Cancer Res. 2020. 80(18): canres.0132.2020. doi：10.1158/0008-5472.can-20-0132
[19]	Zheng W, Li J, Zhou X, et al. The lncRNA XIST promotes proliferation, migration and invasion of gastric cancer cells by targeting miR-337[J]. Arab J Gastroenterol, 2020, 21(3): 199-206. doi：10.1016/j.ajg.2020.07.010
[20]	Patop IL, Wüst S, Kadener S. Past, present, and future of circRNAs[J]. EMBO J, 2019, 38(16): e100836. doi：10.15252/embj.2018100836
[21]	Yu T, Wang Y, Fan Y, et al. CircRNAs in cancer metabolism: a review[J]. J Hematol Oncol, 2019, 12(1): 90. doi：10.1186/s13045-019-0776-8
[22]	Yang R, Cui J. Advances and applications of RNA vaccines in tumor treatment[J]. Mol Cancer, 2024, 23(1): 226. doi：10.1186/s12943-024-02141-5
[23]	Yi Q, Feng JG, Lan WW, et al. CircRNA and lncRNA-encoded peptide in diseases, an update review[J]. Mol Cancer, 2024, 23(1): 214. doi：10.1186/s12943-024-02131-7
[24]	Zhang S, Zhang P, Wu A, et al. Downregulated M6A modification and expression of circRNA_103239 promoted the progression of glioma by regulating the miR-182-5p/MTSS1 signalling pathway[J]. J Cancer, 2023, 14(18): 3508-20. doi：10.7150/jca.85320
[25]	Dai YH, Zhao SH, Chen HL, et al. RNA methylation and breast cancer: insights into m6A, m7G and m5C[J]. Mol Biol Rep, 2024, 52(1): 27. doi：10.1007/s11033-024-10138-y
[26]	Lin ZY, Wan AH, Sun L, et al. N6-methyladenosine demethylase FTO enhances chemo-resistance in colorectal cancer through SIVA1-mediated apoptosis[J]. Mol Ther, 2023, 31(2): 517-34. doi：10.1016/j.ymthe.2022.10.012
[27]	Zhang C, Huang S, Zhuang H, et al. YTHDF2 promotes the liver cancer stem cell phenotype and cancer metastasis by regulating OCT4 expression via m6A RNA methylation[J]. Oncogene, 2020, 39(23): 4507-18. doi：10.1038/s41388-020-1303-7
[28]	Chang H, Yang J, Wang Q, et al. Role of N6-methyladenosine modification in pathogenesis of ischemic stroke[J]. Expert Rev Mol Diagn, 2022, 22(3): 295-303. doi：10.1080/14737159.2022.2049246
[29]	Li L, Zhang T, Xiao M, et al. Brain macrophage senescence in glioma[J]. Semin Cancer Biol, 2024, 104/105: 46-60. doi：10.1016/j.semcancer.2024.07.005
[30]	Davidson CL, Vengoji R, Jain M, et al. Biological, diagnostic and therapeutic implications of exosomes in glioma[J]. Cancer Lett, 2024, 582: 216592. doi：10.1016/j.canlet.2023.216592
[31]	Yin JL, Liu G, Zhang Y, et al. Gender differences in gliomas: From epidemiological trends to changes at the hormonal and molecular levels[J]. Cancer Lett, 2024, 598: 217114. doi：10.1016/j.canlet.2024.217114

circ_EPHB4 synergizes with YTHDF3 to promote glioma progression via m⁶A-dependent stabilization of Wnt3

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 6

References 31

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	Yanpeng PU, Zhen WANG, Haoran CHU. Eye acupuncture improves neural function in rats with cerebral ischemia-reperfusion injury by promoting angiogenesis via upregulating METTL3-mediated m⁶A methylation [J]. Journal of Southern Medical University, 2025, 45(5): 921-928.
[2]	Yuxiang LIAO, Jingping LIU, Bo LIU, Xiyun FEI, Chen JIN. Circ_EPHB4 regulates temozolomide sensitivity in glioma cells through the miR-424-5p/Wnt3 axis [J]. Journal of Southern Medical University, 2025, 45(5): 942-953.
[3]	Chuixing WU, Weixiong ZHONG, Jincheng XIE, Ruimeng YANG, Yuankui WU, Yikai XU, Linjing WANG, Xin ZHEN. An MRI multi-sequence feature imputation and fusion mutual-aid model based on sequence deletion for differentiation of high-grade from low-grade glioma [J]. Journal of Southern Medical University, 2024, 44(8): 1561-1570.
[4]	Ze YANG, Xiusen ZHANG, Xudong ZHANG, Ying LIU, Jiacheng ZHANG, Xiang YUAN. Porphyromonas gingivalis infection facilitates immune escape of esophageal cancer by enhancing YTHDF2-mediated Fas degradation [J]. Journal of Southern Medical University, 2024, 44(6): 1159-1165.
[5]	HUANG Qiuhu, ZHOU Jian, WANG Zizhen, YANG Kun, CHEN Zhenggang. MiR-26-3p regulates proliferation, migration, invasion and apoptosis of glioma cells by targeting CREB1 [J]. Journal of Southern Medical University, 2024, 44(3): 578-584.
[6]	Xiaoyin HUANG, Fenglian CHEN, Yu ZHANG, Shujun LIANG. A predictive model for survival outcomes of glioma patients based on multi-parametric, multi-regional MRI radiomics features and clinical features [J]. Journal of Southern Medical University, 2024, 44(10): 2004-2014.
[7]	ZHANG Zhenyang, XIE Jincheng, ZHONG Weixiong, LIANG Fangrong, YANG Ruimeng, ZHEN Xin. A multi-modal feature fusion classification model based on distance matching and discriminative representation learning for differentiation of high-grade glioma from solitary brain metastasis [J]. Journal of Southern Medical University, 2024, 44(1): 138-145.
[8]	YU Zhengtao, LI Jiameng, JIANG Junwen, LI You, LIN Long, XIA Ying, WANG Lei. miRNA-128-3p inhibits malignant behavior of glioma cells by downregulating KLHDC8A expression [J]. Journal of Southern Medical University, 2023, 43(9): 1447-1459.
[9]	CHU Zhiqin, QU Yaoming, ZHONG Tao, LIANG Shujun, WEN Zhibo, ZHANG Yu. A Dual-Aware deep learning framework for identification of glioma isocitrate dehydrogenase genotype using magnetic resonance amide proton transfer modalities [J]. Journal of Southern Medical University, 2023, 43(8): 1379-1387.
[10]	YE Jingjing, XU Wenqin, XI Bangsheng, WANG Nengqian, CHEN Tianbing. Lactate-induced up-regulation of PLEKHA4 promotes proliferation and apoptosis of human glioma cells [J]. Journal of Southern Medical University, 2023, 43(7): 1071-1080.
[11]	LU Mingjun, QU Yaoming, MA Andong, ZHU Jianbin, ZOU Xia, LIN Gengyun, LI Yuxin, LIU Xinzi, WEN Zhibo. Prediction of 1p/19q codeletion status in diffuse lower-grade glioma using multimodal MRI radiomics [J]. Journal of Southern Medical University, 2023, 43(6): 1023-1028.
[12]	XU Wenqin, YE Jingjing, WANG Fei, CHEN Tianbing. Piroctone olamine disrupts mitochondrial dynamics in glioma cells through the PI3K/AKT pathway [J]. Journal of Southern Medical University, 2023, 43(5): 764-771.
[13]	SUN Jiangchuan, XING Jiaheng, TAN Ruxue, QIAN Ying, TIAN Nan. Curcumol reverses temozolomide resistance in glioma cells by regulating the UTX/MGMT axis [J]. Journal of Southern Medical University, 2023, 43(10): 1697-1705.
[14]	CUI Ying, FAN Shuizhi, PAN Didi, CHAO Qing. Atorvastatin inhibits malignant behaviors and induces apoptosis in human glioma cells by up-regulating miR-146a and inhibiting the PI3K/Akt signaling pathway [J]. Journal of Southern Medical University, 2022, 42(6): 899-904.
[15]	YANG Xuezhi, SHEN Hong, LI Qun, DAI Zichao, YANG Rongqiang, HUANG Guobin, CHEN Rui, WANG Fang, SONG Jingling, HUA Hairong. Interference of P2X4 receptor expression in tumor-associated macrophages suppresses migration and invasion of glioma cells [J]. Journal of Southern Medical University, 2022, 42(5): 658-664.