Xiaoyao San alleviates abnormal α‑syn aggregation and neuronal injury in a Caenorhabditis elegans model of Parkinson disease via the SKN-1 antioxidative pathway

doi:10.12122/j.issn.1673-4254.2026.09.03

Abstract

Abstract:

Objective To investigate the neuroprotective effects of XiaoyaoSan (XYS) in a Caenorhabditis elegans (C. elegans) model of Parkinson disease (PD) and explore its molecular mechanism. Methods A PD model was established in C. elegans using 6-hydroxydopamine (6-OHDA) and validated using a transgenic strain overexpressing α‑synuclein (α‑syn) (NL5901). The worms were treated with 25, 50 or 100 μg/mL XYS, and their lifespan was recorded. Their motor function and food-related behaviors were evaluated by counting body bends within 20 s and observing the basal slowing response. Dopaminergic neuron degeneration and α‑syn aggregation were observed in GFP-labeled transgenic worms. Intracellular ROS levels were measured using a DHE fluorescent probe, and the mRNA expressions of dat-1, cat-2, ced-9, gst-4, and sod-3 were analyzed using RT-qPCR. RNA interference (RNAi) was employed to knock down skn-1 expression to determine whether the effects of XYS depend on the SKN-1/Nrf2 signaling pathway. Results XYS significantly prolonged the lifespan of PD model worms, increased their body bends within 20 s on day 5 and day 10, and improved the basal slowing response. XYS obviously alleviated 6-OHDA-induced dopaminergic neuronal damage, upregulated the expression of dat-1, cat-2, and ced-9, and reduced α‑syn accumulation. Treatment with XYS decreased reactive oxygen species (ROS) levels and upregulated the antioxidant-related genes including sod-3 and gst-4. Mechanistic studies showed that XYS significantly enhanced skn-1::GFP and sod-3::GFP fluorescence signals. Knocking down skn-1 resulted in decreased lipid content in the worms, and XYS failed to significantly reverse this change; skn-1 knockdown also abolished the restorative effect of XYS on sod-3::GFP fluorescence reduction. Conclusion XYS improves neurological function in Caenorhabditis elegans PD model by alleviating oxidative stress and suppressing abnormal α‑syn aggregation, and its neuroprotective effect is mediated probably by the SKN-1/Nrf2-related antioxidant pathway.

Key words: Xiaoyao San, Parkinson disease, dopaminergic neurons, 6-hydroxydopamine, α-synuclein, C. elegans

Lixuan YE, Yuxin LIAO, Qiong LIU, Jia ZHANG, Lei GAO, Zhaoyang DONG. Xiaoyao San alleviates abnormal α‑syn aggregation and neuronal injury in a Caenorhabditis elegans model of Parkinson disease via the SKN-1 antioxidative pathway[J]. Journal of Southern Medical University, 2026, 46(9): 2023-2034.

Figures/Tables 11

Tab.1 Chromatography gradient program

Time (min)	Flow (mL/min)	% B
0.00	0.30	5.0
2.00	0.30	5.0
18.00	0.30	95.0
20.00	0.30	95.0

Tab.2 Primer sequences of target genes

Gene	Forward primer (5'-3')	Reverse primer (5'-3')
Dat-1	TTGGTGCCTACAGACGATCC	GCTGTTCCGTCTTCTGACCA
Cat-2	ACTGAAGAACCTGCGGTACG	CCGATGGTGATTGCTCCTGC
Gst-4	GATGCTCGTGCTCTTGCTGA	GGAGTCGTTGGCTTCAGCTT
Ced-9	TGCTCAGGACTTGCCATCAC	GCGTGAAATAGTCGACCACA
Sod-3	ATCTACTGCTCGCACTGCTT	ACGTAGGTGGCATGATGCTT
β-actin	ACGACGAGTCCGGCCCATCC	GAAAGCTGGTGGTGACGATGGTT

Fig.1 UHPLC-HRMS total ion chromatogram (TIC) of Xiaoyao San (XYS). A: Positive ion mode (POS). B: Negative ion mode (NEG).

Fig.2 XYS extends lifespan and improves locomotor activity of C. elegans PD models. A: Survival curves of C. elegans exposed to different concentrations of XYS. B: Schematic diagram of the experimental design for combined 6-OHDA and XYS treatment. C: Survival curves of 6-OHDA-induced PD model worms with or without XYS treatment. D: Quantification of the basal slowing response. E: Quantification of body bends within 20 s on days 5 and 10 post-treatment. Data represent Mean±SD from at least 3 independent biological replicates (n=50 for lifespan assays and n=30 for other assays). #P<0.05, ##P<0.01 vs control group; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs model group.

Fig.3 XYS extends lifespan and reduces α-syn aggregation in NL5901 worms. A: Survival curves of NL5901 worms with or without XYS treatment. B: Quantification of body bends within 20 s on days 5 and 10 post-treatment. C: Representative images of α‑syn::YFP fluorescence in body wall muscle cells and quantification of fluorescence intensity (Scale bar=100 μm). Data represent Mean±SD from at least 3 independent biological replicates (n=50 for lifespan assays and n=30 for other assays). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs control group.

Fig.4 XYS protects against 6-OHDA-induced dopaminergic neurodegeneration in C. elegans. A: Representative GFP images of dopaminergic neurons with or without XYS treatment and quantification of fluorescence intensity (Scale bar=100 μm). B: Relative mRNA expression levels of dat-1, cat-2, and ced-9. Data represent Mean±SD from at least three independent biological replicates (n=30 for fluorescence analysis and n=3 for qPCR analysis). ##P<0.01, ###P<0.001, ####P<0.0001 vs control group; **P<0.01, ***P<0.001, ****P<0.0001 vs model group.

Fig.5 XYS significantly enhances antioxidant capacity in C. elegans. A: Representative fluorescence images of sod-3::GFP worms and quantification of sod-3::GFP fluorescence intensity (Scale bar=100 μm). B: Relative mRNA expression levels of sod-3 and gst-4. Data represent Mean±SD from at least 3 independent biological replicates (n=30 for fluorescence analysis and n=3 for qPCR analysis). *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs control group.

Fig.6 XYS significantly reduces oxidative stress levels in different C. elegans models of PD. A: Representative DHE staining images of NL5901 worms with or without XYS treatment and quantification of DHE fluorescence intensity. B: Representative DHE staining images of 6-OHDA-treated N2 worms with or without XYS treatment and quantification of DHE fluorescence intensity. Scale bar=100 μm. Data represent Mean±SD from at least 3 independent biological replicates (n=30). ####P<0.0001 vs control group; *P<0.05, **P<0.01 vs model group.

Fig.7 XYS improves antioxidant responses in PD C. elegans models through upregulation of SKN-1. A: Representative fluorescence images of LD1 worms. B: Quantification of fluorescence intensity in LD1 worms. C: Quantification of fluorescence intensity in CF1553 worms. D: Representative fluorescence images of CF1553 worms. E: Representative fluorescence images of skn-1 RNAi-treated worms and quantification of fluorescence intensity. Scale bar=100 μm. Data represent Mean±SD from at least 3 independent biological replicates (n=30). ##P<0.01, ###P<0.001 vs control group; #P<0.05 vs skn-1 RNAi group; *P<0.05, **P<0.01 vs model group.

Fig.8 XYS ameliorates lipid metabolic dysfunction in PD C. elegans models. A: Representative fluorescence images of LIU104 worms and quantification of fluorescence intensity. B: Representative fluorescence images of DMS303 worms and quantification of fluorescence intensity. C: Representative Nile Red staining images of NL5901 worms and quantification of fluorescence intensity. Scale bar=100 μm. Data represent Mean±SD from at least 3 independent biological replicates (n=30). #P<0.05, ##P<0.01 vs control group; *P<0.05, **P<0.01 vs model group.

Fig.9 XYS regulates α-synuclein accumulation and lipid deposition via skn-1. A: Representative fluorescence images of skn-1 RNAi worms and quantification of fluorescence intensity. B: Representative Nile Red staining images of skn-1 RNAi worms and quantification of lipid accumulation based on Nile Red staining. Scale bar=100 μm. Data represent Mean±SD from at least 3 independent biological replicates (n=30). ##P<0.01, ###P<0.001 vs control group.

References 38

[1]	Tanner CM, Ostrem JL. Parkinson's disease[J]. N Engl J Med, 2024, 391(5): 442-52. doi：10.1056/nejmra2401857
[2]	Chen Y, Luo XX, Yin YK, et al. The interplay of iron, oxidative stress, and α-synuclein in Parkinson's disease progression[J]. Mol Med, 2025, 31(1): 154. doi：10.1186/s10020-025-01208-3
[3]	Blackwell TK, Steinbaugh MJ, Hourihan JM, et al. SKN-1/Nrf, stress responses, and aging in Caenorhabditis elegans [J]. Free Radic Biol Med, 2015, 88: 290-301. doi：10.1016/j.freeradbiomed.2015.06.008
[4]	Chen JB, Lei CF, Li XJ, et al. Research progress on classical traditional Chinese medicine formula Xiaoyaosan in the treatment of depression[J]. Front Pharmacol, 2022, 13: 925514. doi：10.3389/fphar.2022.925514
[5]	Liu XY, Yan YZ, Jiang AJ, et al. Xiaoyao San against depression via Glia-mediated neuroinflammation using network pharmacology and experimental validation[J]. Sci Rep, 2025, 15: 39708. doi：10.1038/s41598-025-23296-1
[6]	Wei YY, Lin WF, Zhang TH, et al. Effectiveness of traditional Chinese medicineas as an adjunct therapy for refractory schizophrenia: a systematic review and meta analysis[J]. Sci Rep, 2018, 8: 6230. doi：10.1038/s41598-018-24547-0
[7]	Chen JX, Xu JK, Huang P, et al. The potential applications of traditional Chinese medicine in Parkinson's disease: a new opportunity[J]. Biomed Pharmacother, 2022, 149: 112866. doi：10.1016/j.biopha.2022.112866
[8]	Zhang Y, Xu XM. Chinese herbal medicine in the treatment of depression in Parkinson's disease: from molecules to systems[J]. Front Pharmacol, 2022, 13: 879459. doi：10.3389/fphar.2022.879459
[9]	Xu Y, Chen WY, Chen ZR, et al. Mechanism of action of Xiaoyao San in treatment of ischemic stroke is related to anti-apoptosis and activation of PI3K/Akt pathway[J]. Drug Des Devel Ther, 2021, 15: 753-67. doi：10.2147/dddt.s280217
[10]	Magalingam KB, Radhakrishnan A, Haleagrahara N. Protective effects of quercetin glycosides, rutin, and isoquercetrin against 6-hydroxydopamine (6-OHDA)‑induced neurotoxicity in rat pheo-chromocytoma (PC-12) cells[J]. Int J Immunopathol Pharmacol, 2016, 29(1): 30-9. doi：10.1177/0394632015613039
[11]	Singh S, Kumar P. Piperine in combination with quercetin halt 6-OHDA induced neurodegeneration in experimental rats: Biochemical and neurochemical evidences[J]. Neurosci Res, 2018, 133: 38-47. doi：10.1016/j.neures.2017.10.006
[12]	Hu K, Zhu SS, Wu FY, et al. Aureusidin ameliorates 6-OHDA-induced neurotoxicity via activating Nrf2/HO-1 signaling pathway and preventing mitochondria-dependent apoptosis pathway in SH-SY5Y cells and Caenorhabditis elegans [J]. Chem Biol Interact, 2024, 387: 110824. doi：10.1016/j.cbi.2023.110824
[13]	Tamuli R, Mellick GD, Schirra HJ, et al. Mode of action of toxin 6-hydroxydopamine in SH-SY5Y using NMR metabolomics[J]. Molecules, 2025, 30(16): 3352. doi：10.3390/molecules30163352
[14]	Kimble J, Nüsslein-Volhard C. The great small organisms of developmental genetics: Caenorhabditis elegans and Drosophila melanogaster [J]. Dev Biol, 2022, 485: 93-122. doi：10.1016/j.ydbio.2022.02.013
[15]	Ma JY, Li KL, Shi SL, et al. The application of UHPLC-HRMS for quality control of traditional Chinese medicine[J]. Front Pharmacol, 2022, 13: 922488. doi：10.3389/fphar.2022.922488
[16]	陈周雯, 任雨敏, 唐鲜, 等. 西南手参醇提物通过抗氧化途径延缓秀丽隐杆线虫衰老的机制[J]. 食品科学, 2026, 47(6): 214-25. doi：10.7506/spkx1002-6630-20250910-079
[17]	Offenburger SL, Ho XY, Tachie-Menson T, et al. 6-OHDA-induced dopaminergic neurodegeneration in Caenorhabditis elegans is promoted by the engulfment pathway and inhibited by the transthyretin-related protein TTR-33[J]. PLoS Genet, 2018, 14(1): e1007125. doi：10.1371/journal.pgen.1007125
[18]	Tsai RT, Tsai CW, Liu SP, et al. Maackiain ameliorates 6-hydroxydopamine and SNCA pathologies by modulating the PINK1/parkin pathway in models of Parkinson's disease in Caenorhabditis elegans and the SH-SY5Y cell line[J]. Int J Mol Sci, 2020, 21(12): 4455. doi：10.3390/ijms21124455
[19]	Palikaras K, SenGupta T, Nilsen H, et al. Assessment of dopaminergic neuron degeneration in a C. elegans model of Parkinson's disease[J]. STAR Protoc, 2022, 3(2): 101264. doi：10.1016/j.xpro.2022.101264
[20]	Balkrishna A, Pathak N, Singh R, et al. Neurogrit gold attenuates 6-OHDA-induced dopaminergic neurodegeneration in Parkinson's model of Caenorhabditis elegans by reducing α‑synuclein accumulation and pink/pdr-1 driven mitochondrial dysfunction[J]. CNS Neurosci Ther, 2025, 31(5): e70401. doi：10.1111/cns.70401
[21]	Sawin ER, Ranganathan R, Horvitz HR. C. elegans locomotory rate is modulated by the environment through a dopaminergic pathway and by experience through a serotonergic pathway[J]. Neuron, 2000, 26(3): 619-31. doi：10.1016/s0896-6273(00)81199-x
[22]	Picca A, Calvani R, Coelho-Junior HJ, et al. Mitochondrial dysfunction, oxidative stress, and neuroinflammation: intertwined roads to neurodegeneration[J]. Antioxidants, 2020, 9(8): 647. doi：10.3390/antiox9080647
[23]	Fu RH, Tsai CW, Liu SP, et al. Neuroprotective capability of narcissoside in 6-OHDA-exposed Parkinson's disease models through enhancing the MiR200a/nrf-2/GSH axis and mediating MAPK/Akt associated signaling pathway[J]. Antioxidants, 2022, 11(11): 2089. doi：10.3390/antiox11112089
[24]	Kwon TG, Kim YJ, Hong JY, et al. A review of antidepressant and anxiolytic effects of Soyo-San (Xiaoyao-San) and modified Soyo-San in animal models[J]. Phytomedicine, 2024, 135: 155387. doi：10.1016/j.phymed.2024.155387
[25]	Bastien BL, Haury WR, Smisko WR, et al. Nlr-1/CNTNAP regulates dopamine circuit structure and foraging behaviors in C. elegans[J]. Commun Biol, 2024, 7: 1248. doi：10.1038/s42003-024-06936-6
[26]	Lee I, Knickerbocker AC, Depew CR, et al. Effect of altered production and storage of dopamine on development and behavior in C. elegans[J]. Front Toxicol, 2024, 6: 1374866. doi：10.3389/ftox.2024.1374866
[27]	Jeong H, Park JY, Lee JH, et al. Deficiency in RCAT-1 function causes dopamine metabolism related behavioral disorders in Caenorhabditis elegans [J]. Int J Mol Sci, 2022, 23(4): 2393. doi：10.3390/ijms23042393
[28]	Maulik M, Mitra S, Bult-Ito A, et al. Behavioral phenotyping and pathological indicators of Parkinson's disease in C. elegans models[J]. Front Genet, 2017, 8: 77. doi：10.3389/fgene.2017.00077
[29]	Abidar S, Nhiri M, Hritcu L. Phytochemicals against the 6-hydroxydopamine-induced Parkinson's disease in rodents: a systematic review[J]. Next Res, 2025, 2(3): 100473. doi：10.1016/j.nexres.2025.100473
[30]	Kim KH, Lee SY, Shin J, et al. Dose-dependent neuroprotective effect of standardized bee venom phospholipase a(2) against MPTP-induced Parkinson's disease in mice[J]. Front Aging Neurosci, 2019, 11: 80. doi：10.3389/fnagi.2019.00080
[31]	Liu XJ, Zheng ZJ, Xue C, et al. LRRK2 mediates α‑synuclein-induced neuroinflammation and ferroptosis through the p62-Keap1-Nrf2 pathway in Parkinson's disease[J]. Inflammation, 2025, 48(5): 3666-91. doi：10.1007/s10753-025-02291-8
[32]	Chakraborty S, Bornhorst J, Nguyen TT, et al. Oxidative stress mechanisms underlying Parkinson's disease-associated neuro-degeneration in C. elegans[J]. Int J Mol Sci, 2013, 14(11): 23103-28. doi：10.3390/ijms141123103
[33]	Phan HD, Nguyen TTM, Lee S, et al. The metabolic contribution of SKN-1/Nrf2 to the lifespan of Caenorhabditis elegans [J]. Metabolomics, 2023, 19(6): 58. doi：10.1007/s11306-023-02022-w
[34]	Pang SS, Lynn DA, Lo JY, et al. SKN-1 and Nrf2 couples proline catabolism with lipid metabolism during nutrient deprivation[J]. Nat Commun, 2014, 5: 5048. doi：10.1038/ncomms6048
[35]	Zhao CY, Tu J, Wang CC, et al. Lysophosphatidylcholine binds α‑synuclein and prevents its pathological aggregation[J]. Natl Sci Rev, 2024, 11(6): nwae182. doi：10.1093/nsr/nwae182
[36]	Lastres-Becker I, Ulusoy A, Innamorato NG, et al. α‑Synuclein expression and Nrf2 deficiency cooperate to aggravate protein aggregation, neuronal death and inflammation in early-stage Parkinson's disease[J]. Hum Mol Genet, 2012, 21(14): 3173-92. doi：10.1093/hmg/dds143
[37]	Idi W, Sheta R, Oueslati A. Interplay between lipid droplets and alpha-synuclein: implication in Parkinson's disease pathogenesis[J]. Front Mol Neurosci, 2025, 18: 1681039. doi：10.3389/fnmol.2025.1681039
[38]	Coles NP, Elsheikh S, Quesnel A, et al. Alpha-synuclein aggregation induces prominent cellular lipid changes as revealed by Raman spectroscopy and machine learning analysis[J]. Brain Commun, 2025, 7(2): fcaf133. doi：10.1093/braincomms/fcaf133