The TGF‑β/miR-23a-3p/IRF1 axis mediates immune escape of hepatocellular carcinoma by inhibiting major histocompatibility complex class I

doi:10.12122/j.issn.1673-4254.2025.07.06

Abstract

Abstract:

Objective To investigate the mechanism by which transforming growth factor‑β (TGF‑β) regulates major histocompatibility complex class I (MHC-I) expression in hepatocellular carcinoma (HCC) cells and its role in immune evasion of HCC. Methods HCC cells treated with TGF‑β alone or in combination with SB-431542 (a TGF-β type I receptor inhibitor) were examined for changes in MHC-I expression using RT-qPCR and Western blotting. A RNA interference experiment was used to explore the role of miR-23a-3p/IRF1 signaling in TGF‑β‑mediated regulation of MHC-I. HCC cells with different treatments were co-cultured with human peripheral blood mononuclear cells (PBMCs), and the changes in HCC cell proliferation was assessed using CCK-8 and colony formation assays. T-cell cytotoxicity in the co-culture systems was assessed with lactate dehydrogenase (LDH) release and JC-1 mitochondrial membrane potential assays, and T-cell activation was evaluated by flow cytometric analysis of CD69 cells and ELISA for TNF-α secretion. Results TGF‑β treatment significantly suppressed MHC-I expression in HCC cells and reduced T-cell activation, leading to increased tumor cell proliferation and decreased HCC cell death in the co-culture systems. Mechanistically, TGF-β upregulated miR-23a-3p, which directly targeted IRF1 to inhibit MHC-I transcription. Overexpression of miR-23a-3p phenocopied TGF‑β‑induced suppression of IRF1 and MHC-I. Conclusion We reveal a novel immune escape mechanism of HCC, in which TGF‑β attenuates T cell-mediated antitumor immunity by suppressing MHC-I expression through the miR-23a-3p/IRF1 signaling axis.

Key words: liver cancer cells, transforming growth factor-β, major histocompatibility complex class I, tumor immune escape

Ying YU, Li TU, Yang LIU, Xueyi SONG, Qianqian SHAO, Xiaolong TANG. The TGF‑β/miR-23a-3p/IRF1 axis mediates immune escape of hepatocellular carcinoma by inhibiting major histocompatibility complex class I[J]. Journal of Southern Medical University, 2025, 45(7): 1397-1408.

Figures/Tables 9

Tab.1 Sequences of primers for RT-qPCR

Genes	Primer (5′-3′)
HLA-A	F:ACCCTCGTCCTGCTACTCTC
HLA-A	R:CTGTCTCCTCGTCCCAATACT
U6	F:AGAGAAGATTAGCATGGCCCCTG
U6	R:ATCCAGTGCAGGGTC CGAGG
GAPDH	F:CAGGAGGCATTGCTGATGAT
GAPDH	R:GAAGGCTGGGGCTCATTT
miR-23a-3p	F:AGCGCCTATCACATTGCCAGG
miR-23a-3p	R:ATCCAGTGCAGGGTCCGAGG
miR-106b-5p	F: TGCGGCAACACCAGTCGATGG
miR-106b-5p	R: CCAGTGCAGGGTCCGAGGT
miR-17-5p	F: GCGCAAAGTGCTTACAGTGC
miR-17-5p	R:AGTGCAGGGTCCGAGGTATT
miR-24-2-5p	F: GCGGTGCCTACTGAGCTGA
miR-24-2-5p	R:AGTGCAGGGTCCGAGGTATT

Fig.1 TGF-β down-regulates the expression of MHC-I molecules in hepatocellular carcinoma (HCC) cell lines. A, B: Western blotting of MHC-I protein expression in 4 human HCC cell lines. C: RT-PCR analysis of HLA-A mRNA expression in 4 human HCC cell lines. D, E: Western blotting of MHC-I protein expression in TGF-β-treated HCC cells. F: RT-PCR analysis of HLA-A mRNA expression in TGF-β-treated HCC cells. SB: SB-431542. *P<0.05, **P<0.01.

Fig.2 TGF-β affects PBMC activation and reduces its toxicity and killing effect against HCC cells. A: CCK-8 assay for assessing HCC cell viability in the co-culture models with different treatments. B, C: Clonogenic assay for quantifying colony formation capacity of HCC cells in the co-culture models in different treatment groups. D: LDH release assay for evaluating cytotoxicity in the co-culture models with different treatments. E, F: JC-1 staining for assessing mitochondrial membrane potential of HCC cells in the co-culture models. G: ELISA for detecting TNF-α secretion by activated T cells in the co-culture systems in different groups. H: Flow cytometry for analyzing CD8+ T cell percentage with high expression of CD69 in the co-culture models in different groups. *P<0.05, **P<0.01, ***P<0.001.

Fig.3 TGF‑β decreases the expression level of IRF1. A, B: Western blotting for detecting the expression level of IRF1 in TGF-β treated cells. *P<0.05.

Fig.4 Expression level of IRF1 affects the expression of MHC-I. A-C: Western blotting for detecting expression levels of IRF1 and MHC-I in HCC cells after IRF1 knockdown. *P<0.05, **P<0.01.

Fig.5 Expression of IRF1 affects PBMC activation and reduces its toxicity and killing effect on HCC cells. A: CCK-8 assay for assessing viability of HCC cells with different treatments in the co-culture models. B: LDH release assay for evaluating tumor cell cytotoxicity in the co-culture systems. C,D: JC-1 staining assessing mitochondrial membrane potential of HCC cells in the co-culture models with different treatments. E: ELISA of TNF-α secretion by activated T cells in the co-culture systems. F: Flow cytometric analysis of percentage of CD8+ T cells with high CD69 expression in the co-culture models. *P<0.05, **P<0.01, ***P<0.001.

Fig.6 Prediction of microRNAs targeting IRF1 using TargetScan, miRDB and miRWalk databases.

Fig.7 TGF-β down-regulates MHC-I expression via miR-23a-3p/IRF1. A, B: RT-PCR for analyzing expression levels of miR-23a-3p, miR-106b-5p, miR-17-5p, and miR-24-2-5p in HCC cells after TGF-β treatment. C: RT-qPCR analysis of miR-23a-3p expression in TGF-β-treated cells. D-F: Western blotting of IRF1 and MHC-I protein expressions in HCC cells following modulation of miR-23a-3p expression level. *P<0.05, **P<0.01, ***P<0.001.

Fig.8 MiR-23a-3p affects PBMC activation and reduces its cytotoxicity and killing effect on HCC cells. A: CCK-8 assay of viability of HCC cells with different treatments in the co-culture models. B: LDH release assay for evaluating tumor cell cytotoxicity in the co-culture systems with different treatments. C, D: JC-1 staining for assessing mitochondrial membrane potential of the tumor cells in the co-culture models. E: ELISA quantification of TNF-α secretion by activated T cells in the co-culture systems. F: Flow cytometric analysis of the proportion of CD8+ T cells with high CD69 expression in the co-culture models. *P<0.05, **P<0.01, ***P<0.001.

References 32

[1]	Chakraborty E, Sarkar D. Emerging therapies for hepatocellular carcinoma (HCC)[J]. Cancers: Basel, 2022, 14(11): 2798. doi：10.3390/cancers14030504
[2]	Tümen D, Heumann P, Gülow K, et al. Pathogenesis and current treatment strategies of hepatocellular carcinoma[J]. Biomedicines, 2022, 10(12): 3202. doi：10.3390/biomedicines10123202
[3]	Huang J, Tsang WY, Fang XN, et al. FASN inhibition decreases MHC-I degradation and synergizes with PD-L1 checkpoint blockade in hepatocellular carcinoma[J]. Cancer Res, 2024, 84(6): 855-71. doi：10.1158/0008-5472.can-23-0966
[4]	Chen Y, Qian Y, Huang W, et al. Chronic stress promotes tumor immune evasion via the suppression of MHC-I expression and the upregulation of PD-L1[J]. Am J Cancer Res, 2022, 12(11): 5286-99.
[5]	Cruz FM, Chan A, Rock KL. Pathways of MHC I cross-presentation of exogenous antigens[J]. Semin Immunol, 2023, 66: 101729. doi：10.1016/j.smim.2023.101729
[6]	Dhatchinamoorthy K, Colbert JD, Rock KL. Cancer immune evasion through loss of MHC class I antigen presentation[J]. Front Immunol, 2021, 12: 636568. doi：10.3389/fimmu.2021.636568
[7]	Yamamoto K, Venida A, Yano J, et al. Autophagy promotes immune evasion of pancreatic cancer by degrading MHC-I[J]. Nature, 2020, 581(7806): 100-5. doi：10.1038/s41586-020-2229-5
[8]	Wu X, Li T, Jiang R, et al. Targeting MHC-I molecules for cancer: function, mechanism, and therapeutic prospects[J]. Mol Cancer, 2023, 22(1): 194. doi：10.1186/s12943-023-01899-4
[9]	Xin X, Cheng X, Zeng F, et al. The role of TGF-β/SMAD signaling in hepatocellular carcinoma: from mechanism to therapy and prognosis[J]. Int J Biol Sci, 2024, 20(4): 1436-51. doi：10.7150/ijbs.89568
[10]	Gough NR, Xiang XY, Mishra L. TGF-β signaling in liver, pancreas, and gastrointestinal diseases and cancer[J]. Gastroenterology, 2021, 161(2): 434-52.e15. doi：10.1053/j.gastro.2021.04.064
[11]	Derynck R, Jarrett JA, Chen EY, et al. Human transforming growth factor-beta complementary DNA sequence and expression in normal and transformed cells[J]. Nature, 1985, 316(6030): 701-5. doi：10.1038/316701a0
[12]	Derynck R, Turley SJ, Akhurst RJ. TGFβ biology in cancer progression and immunotherapy[J]. Nat Rev Clin Oncol, 2021, 18(1): 9-34. doi：10.1038/s41571-020-0403-1
[13]	Desbois M, Udyavar AR, Ryner L, et al. Integrated digital pathology and transcriptome analysis identifies molecular mediators of T-cell exclusion in ovarian cancer[J]. Nat Commun, 2020, 11(1): 5583. doi：10.1038/s41467-020-19408-2
[14]	Martini M, Testi MG, Pasetto M, et al. IFN-gamma-mediated upmodulation of MHC class I expression activates tumor-specific immune response in a mouse model of prostate cancer[J]. Vaccine, 2010, 28(20): 3548-57. doi：10.1016/j.vaccine.2010.03.007
[15]	Pan M, Luo M, Liu L, et al. EGR1 suppresses HCC growth and aerobic glycolysis by transcriptionally downregulating PFKL[J]. J Exp Clin Cancer Res, 2024, 43(1): 35. doi：10.1186/s13046-024-02957-5
[16]	Wang Y, Deng B. Hepatocellular carcinoma: molecular mechanism, targeted therapy, and biomarkers[J]. Cancer Metastasis Rev, 2023, 42(3): 629-52. doi：10.1007/s10555-023-10084-4
[17]	Du G, Dou C, Sun P, et al. Regulatory T cells and immune escape in HCC: understanding the tumor microenvironment and advancing CAR-T cell therapy[J]. Front Immunol, 2024, 15: 1431211. doi：10.3389/fimmu.2024.1431211
[18]	Bates JP, Derakhshandeh R, Jones L, et al. Mechanisms of immune evasion in breast cancer[J]. BMC Cancer, 2018, 18(1): 556. doi：10.1186/s12885-018-4441-3
[19]	Ye D, Zhou S, Dai XY, et al. Targeting the MHC-I endosomal-lysosomal trafficking pathway in cancer: From mechanism to immunotherapy[J]. Biochim Biophys Acta BBA Rev Cancer, 2024, 1879(5): 189161. doi：10.1016/j.bbcan.2024.189161
[20]	Dersh D, Hollý J, Yewdell JW. A few good peptides: MHC class I-based cancer immunosurveillance and immunoevasion[J]. Nat Rev Immunol, 2021, 21(2): 116-28. doi：10.1038/s41577-020-0390-6
[21]	Qiao X, Cheng Z, Xue K, et al. Tumor-associated macrophage-derived exosomes LINC01592 induce the immune escape of esophageal cancer by decreasing MHC-I surface expression[J]. J Exp Clin Cancer Res, 2023, 42(1): 289. doi：10.1186/s13046-023-02871-2
[22]	Kong J, Xu S, Zhang P, et al. CXCL1 promotes immune escape in colorectal cancer by autophagy-mediated MHC-I degradation[J]. Hum Immunol, 2023, 84(12): 110716. doi：10.1016/j.humimm.2023.09.002
[23]	Wang XC, Eichhorn PJA, Thiery JP. TGF-β, EMT, and resistance to anti-cancer treatment[J]. Semin Cancer Biol, 2023, 97: 1-11. doi：10.1016/j.semcancer.2023.10.004
[24]	Aashaq S, Batool A, Mir SA, et al. TGF-β signaling: a recap of SMAD-independent and SMAD-dependent pathways[J]. J Cell Physiol, 2022, 237(1): 59-85. doi：10.1002/jcp.30529
[25]	Lee JH, Massagué J. TGF-β in developmental and fibrogenic EMTs[J]. Semin Cancer Biol, 2022, 86: 136-45. doi：10.1016/j.semcancer.2022.09.004
[26]	Shi X, Yang J, Deng S, et al. TGF-β signaling in the tumor metabolic microenvironment and targeted therapies[J]. J Hematol Oncol, 2022, 15(1): 135. doi：10.1186/s13045-022-01349-6
[27]	Zhou F. Molecular mechanisms of IFN-gamma to up-regulate MHC class I antigen processing and presentation[J]. Int Rev Immunol, 2009, 28(3/4): 239-60. doi：10.1080/08830180902978120
[28]	Zhang J, Guo HJ, Wang LS, et al. Cediranib enhances the transcription of MHC-I by upregulating IRF-1[J]. Biochem Pharmacol, 2024, 221: 116036. doi：10.1016/j.bcp.2024.116036
[29]	Tan L, Yin T, Xiang H, et al. Aberrant cytoplasmic expression of UHRF1 restrains the MHC-I-mediated anti-tumor immune response[J]. Nat Commun, 2024, 15(1): 8569. doi：10.1038/s41467-024-52902-5
[30]	Cardenas H, Vieth E, Lee J, et al. TGF-β induces global changes in DNA methylation during the epithelial-to-mesenchymal transition in ovarian cancer cells[J]. Epigenetics, 2014, 9(11): 1461-72. doi：10.4161/15592294.2014.971608
[31]	Guan Z, Song B, Liu F, et al. TGF‑β induces HLA-G expression through inhibiting miR-152 in gastric cancer cells[J]. J Biomed Sci, 2015, 22: 107. doi：10.1186/s12929-015-0177-4
[32]	Zeng XC, Zhang T, Huang DH, et al. RNA interfering targeting human leukocyte antigen-G enhanced immune surveillance mediated by the natural killer cells on hepatocellular carcinoma[J]. Ann Clin Lab Sci, 2013, 43(2): 135-44.