Gastrodin improves microglia-mediated inflammatory response after hypoxic-ischemic brain damage in neonatal rats via PI3K/AKT pathway

doi:10.12122/j.issn.1673-4254.2024.09.11

Abstract

Abstract:

Objective To investigate the mechanism of gastrodin for inhibiting microglia-mediated inflammation after hypoxic-ischemic brain damage (HIBD) in neonatal rats. Methods Thirty-nine 3-day-old SD rats were randomly divided into sham group, HIBD group and gastrodin treatment group. Western blotting was used to detect the expressions of TNF-α, IL-1β, IL-10 and TGF-β1 in the corpus callosum of the rats. The potential targets of gastrodin for treatment of HIBD were screened by network pharmacology analysis. The expressions of PI3K/AKT signaling pathway proteins following HIBD-induced microglial activation in the rats and in cultured microglial BV-2 cells with oxygen-glucose deprivation (OGD) were detected with Western blotting. The effects of LY294002 (a specific inhibitor of the PI3K/AKT pathway) and gastrodin on TNF-α and TGF-β1 mRNA levels in BV-2 cells with OGD was detected with RT-qPCR. Results In the neonatal rats with HIBD, gastrodin treatment significantly decreased TNF-α and IL-1β expressions and enhanced IL-10 and TGF-β1 expressions in the ischemic corpus callosum. Network pharmacology analysis showed significant enrichment of the PI3K/AKT signaling pathway and a strong binding between gastrodin and PI3K. Gastrodin significantly promoted PI3K and AKT phosphorylation in neonatal rats with HIBD and in BV-2 cells exposed to OGD. In BV-2 cells with OGD, gastrodin obviously suppressed OGD-induced increase of TNF‑α and reduction of TGF‑β1 mRNA expressions, and this effect was strongly attenuated by LY294002 treatment. Conclusion Gastrodin can inhibit microglia-mediated inflammation in neonatal rats with HIBD by regulating the PI3K/AKT signaling pathway.

Key words: hypoxic-ischemic brain damage, gastrodin, inflammatory response, oxygen and sugar deprivation, microglia, PI3K/AKT

Hanjun ZUO, Zhaoda DUAN, Zhao WANG, Tao GUO, Jinsha SHI, Haolong SHI, Juanjuan LI. Gastrodin improves microglia-mediated inflammatory response after hypoxic-ischemic brain damage in neonatal rats via PI3K/AKT pathway[J]. Journal of Southern Medical University, 2024, 44(9): 1712-1719.

Figures/Tables 9

Tab.1 Primer sequence for RT-qPCR

Primer	Sequence (5'-3')
TGF-β1 F	GCTGAACCAAGGAGACGGAA
TGF-β1 R	TCTTCTCTGTGGAGCGTTGAT
TNF-α F	ACCCTCACACTCACAAACCA
TNF-α R	GGCAGAGAGGAGGTTGACTTT
β-actin F	GTGGGAATGGGTCAGAAGGA
β-actin R	TACATGGCTGGGGTGTTGAA

Fig.1 Effect of gastrodin on expressions of TNF-α, IL-1β, IL-10 and TGF-β1 proteins in the in brain tissue of neonatal rats at 1 day, 3 days, and 7 days after HIBD detected by Western blotting. A, C, E: Protein blots of TNF-α, IL-1β, IL-10, and TGF-β1. B, D, F: Quantification of TNF-α, IL-1β, IL-10, and TGF-β1 expression levels. *P<0.05, **P<0.01, ***P<0.001 (n=3).

Fig.2 PPI network diagram and GO enrichment analysis of potential core target of gastrodin treatment of HIBD. A: PPI network diagram. B: GO enrichment analysis.

Fig.3 KEGG enrichment analysis of potential core targets for gastrodin treatment of HIBD. A, B: KEGG pathway enrichment analysis.

Fig.4 Gastrodin and PI3K signaling pathway visualization protein molecular docking.

Fig.5 Effect of gastrodin on expressions of PI3K/AKT signaling pathway in activated microglia of neonatal rats at 1 day, 3 days, and 7 days after HIBD detected by Western blotting. A, C, E: Western blots of the related proteins in PI3K/AKT signaling pathway. B, D, F: Quantification of P-PI3K, PI3K, P-AKT, and AKT protein levels. *P<0.05, **P<0.01, ***P<0.001 (n=3).

Fig.6 Effect of gastrodin on expression of PI3K/AKT signaling pathway in activated microglia BV-2 cells after OGD detected by western blotting. A: Western blots of the related proteins in PI3K/AKT signaling pathway in BV-2 cells. B: Quantification of P-PI3K, PI3K, P-AKT, and AKT protein levels. *P<0.05, **P<0.01 (n=3).

Fig.7 The cytotoxic effect of LY294002 on BV-2 cells was detected by CCK8 kit.

Fig.8 Effect of gastrodin and LY294002 on TNF-α (A) and TGF-β1 mRNA (B) expressions in BV-2 cells with OGD detected by RT-qPCR. *P<0.05, **P<0.01, ***P<0.001 (n=3).

References 36

1	Le K, Song ZP, Deng J, et al. Quercetin alleviates neonatal hypoxic-ischemic brain injury by inhibiting microglia-derived oxidative stress and TLR4-mediated inflammation[J]. Inflamm Res, 2020, 69(12): 1201-13.
2	Lawn JE, Blencowe H, Oza S, et al. Every Newborn: progress, priorities, and potential beyond survival[J]. Lancet, 2014, 384(9938): 189-205.
3	Douglas-Escobar M, Weiss MD. Hypoxic-ischemic encephalopathy: a review for the clinician[J]. JAMA Pediatr, 2015, 169(4): 397-403.
4	Zalewska T, Jaworska J, Ziemka-Nalecz M. Current and experimental pharmacological approaches in neonatal hypoxic- ischemic encephalopathy[J]. Curr Pharm Des, 2015, 21(11): 1433-9.
5	Gunn AJ, Thoresen M. Neonatal encephalopathy and hypoxic-ischemic encephalopathy[J]. Handb Clin Neurol, 2019, 162: 217-37.
6	Wassink G, Davidson JO, Dhillon SK, et al. Therapeutic hypothermia in neonatal hypoxic-ischemic encephalopathy[J]. Curr Neurol Neurosci Rep, 2019, 19(2): 2.
7	Wood T, Osredkar D, Puchades M, et al. Treatment temperature and insult severity influence the neuroprotective effects of therapeutic hypothermia[J]. Sci Rep, 2016, 6: 23430.
8	Wu YW, Mathur AM, Chang T, et al. High-dose erythropoietin and hypothermia for hypoxic-ischemic encephalopathy: a phase II trial[J]. Pediatrics, 2016, 137(6): e20160191.
9	Hagberg H, Mallard C, Ferriero DM, et al. The role of inflammation in perinatal brain injury[J]. Nat Rev Neurol, 2015, 11(4): 192-208.
10	Deng WB. Neurobiology of injury to the developing brain[J]. Nat Rev Neurol, 2010, 6(6): 328-36.
11	Zhou DD, Ji L, Chen YG. TSPO modulates IL-4-induced microglia/macrophage M2 polarization via PPAR‑γ pathway[J]. J Mol Neurosci, 2020, 70(4): 542-9.
12	Kim HJ, Moon KD, Lee DS, et al. Ethyl ether fraction of Gastrodia elata Blume protects amyloid beta peptide-induced cell death[J]. J Ethnopharmacol, 2003, 84(1): 95-8.
13	Kim HJ, Moon KD, Oh SY, et al. Ether fraction of methanol extracts of Gastrodia elata, a traditional medicinal herb, protects against kainic acid-induced neuronal damage in the mouse hippocampus[J]. Neurosci Lett, 2001, 314(1/2): 65-8.
14	Zeng XH, Zhang SM, Zhang L, et al. A study of the neuroprotective effect of the phenolic glucoside gastrodin during cerebral ischemia in vivo and in vitro [J]. Planta Med, 2006, 72(15): 1359-65.
15	Deng CJ, Chen HZ, Meng ZY, et al. Gastrodin and vascular dementia: advances and current perspectives[J]. Evid Based Complement Alternat Med, 2022: 2563934.
16	Liu Y, Gao JL, Peng M, et al. A review on central nervous system effects of gastrodin[J]. Front Pharmacol, 2018, 9: 24.
17	Zhang JQ, Li LY, Liu Q, et al. Gastrodin programs an Arg-1⁺ microglial phenotype in hippocampus to ameliorate depression- and anxiety-like behaviors via the Nrf2 pathway in mice[J]. Phytomedicine, 2023, 113: 154725.
18	Guo J, Zhang XL, Bao ZR, et al. Gastrodin regulates the Notch signaling pathway and Sirt3 in activated microglia in cerebral hypoxic-ischemia neonatal rats and in activated BV-2 microglia[J]. Neuromolecular Med, 2021, 23(3): 348-62.
19	Zhu M, Li D, Wu Y, et al. TREM-2 promotes macrophage-mediated eradication of Pseudomonas aeruginosa via a PI3K/Akt pathway[J]. Scand J Immunol, 2014, 79(3): 187-96.
20	Lv MR, Li B, Wang MG, et al. RETRACTED: activation of the PI3K-Akt pathway promotes neuroprotection of the δ‑opioid receptor agonist against cerebral ischemia-reperfusion injury in rat models[J]. Biomedecine Pharmacother, 2017, 93: 230-7.
21	Tu XK, Zhang HB, Shi SS, et al. 5-LOX inhibitor zileuton reduces inflammatory reaction and ischemic brain damage through the activation of PI3K/akt signaling pathway[J]. Neurochem Res, 2016, 41(10): 2779-87.
22	Liu SJ, Liu XY, Li JH, et al. Gastrodin attenuates microglia activation through renin-angiotensin system and Sirtuin3 pathway[J]. Neurochem Int, 2018, 120: 49-63.
23	Chen Z, Hu Y, Lu RF, et al. MicroRNA-374a-5p inhibits neuroinflammation in neonatal hypoxic-ischemic encephalopathy via regulating NLRP3 inflammasome targeted Smad6[J]. Life Sci, 2020, 252: 117664.
24	Karve IP, Taylor JM, Crack PJ. The contribution of astrocytes and microglia to traumatic brain injury[J]. Br J Pharmacol, 2016, 173(4): 692-702.
25	Shrivastava SK, Dalko E, Delcroix-Genete D, et al. Uptake of parasite-derived vesicles by astrocytes and microglial phagocytosis of infected erythrocytes may drive neuroinflammation in cerebral malaria[J]. Glia, 2017, 65(1): 75-92.
26	Nayak D, Roth TL, McGavern DB. Microglia development and function[J]. Annu Rev Immunol, 2014, 32: 367-402.
27	Lalancette-Hébert M, Gowing G, Simard A, et al. Selective ablation of proliferating microglial cells exacerbates ischemic injury in the brain[J]. J Neurosci, 2007, 27(10): 2596-605.
28	Tsuji S, di Martino E, Mukai T, et al. Aggravated brain injury after neonatal hypoxic ischemia in microglia-depleted mice[J]. J Neuroinflammation, 2020, 17(1): 111.
29	Serdar M, Kempe K, Rizazad M, et al. Early pro-inflammatory microglia activation after inflammation-sensitized hypoxic-ischemic brain injury in neonatal rats[J]. Front Cell Neurosci, 2019, 13: 237.
30	Dai JN, Zong Y, Zhong LM, et al. Gastrodin inhibits expression of inducible NO synthase, cyclooxygenase-2 and proinflammatory cytokines in cultured LPS-stimulated microglia via MAPK pathways[J]. PLoS One, 2011, 6(7): e21891.
31	Peng Z, Wang H, Zhang R, et al. Gastrodin ameliorates anxiety-like behaviors and inhibits IL-1beta level and p38 MAPK phosphorylation of hippocampus in the rat model of posttraumatic stress disorder[J]. Physiol Res, 2013, 62(5): 537-45.
32	Jafari M, Ghadami E, Dadkhah T, et al. PI₃k/AKT signaling pathway: erythropoiesis and beyond[J]. J Cell Physiol, 2019, 234(3): 2373-85.
33	Wang JT, Ma WM, Liu YD. Long non-coding RNA HULC promotes bladder cancer cells proliferation but inhibits apoptosis via regulation of ZIC2 and PI3K/AKT signaling pathway[J]. Cancer Biomark, 2017, 20(4): 425-34.
34	Choudhury R, Bonacci T, Wang XX, et al. The E3 ubiquitin ligase SCF(cyclin F) transmits AKT signaling to the cell-cycle machinery[J]. Cell Rep, 2017, 20(13): 3212-22.
35	Xian MH, Cai JL, Zheng KN, et al. Aloe-emodin prevents nerve injury and neuroinflammation caused by ischemic stroke via the PI3K/AKT/mTOR and NF-κB pathway[J]. Food Funct, 2021, 12(17): 8056-67.
36	Wang XS, Tian Z, Zhang N, et al. Protective effects of gastrodin against autophagy-mediated astrocyte death[J]. Phytother Res, 2016, 30(3): 386-96.

[1]	Xueli ZHOU, Hua LI, Qingyu CHEN, Meina JIN, Haibo LI, Wei BAI, Chuxuan JIA, Cuiying WEI. Effects of chronic intermittent hypoxia and reoxygenation on insulin resistance and skeletal muscle miR-27a-3p/PPARγ/IRS1/PI3K/AKT expressions in rats [J]. Journal of Southern Medical University, 2024, 44(9): 1729-1737.
[2]	Xianheng ZHANG, Jian LIU, Qi HAN, Yiming CHEN, Xiang DING, Xiaolu CHEN. Huangqin Qingrechubi Capsule alleviates inflammation and uric acid and lipid metabolism imbalance in rats with gouty arthritis by inhibiting the PTEN/PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2024, 44(8): 1450-1458.
[3]	Zhijun GENG, Jingjing YANG, Minzhu NIU, Xinyue LIU, Jinran SHI, Yike LIU, Xinyu YAO, Yulu ZHANG, Xiaofeng ZHANG, Jianguo HU. Kuwanon G inhibits growth, migration and invasion of gastric cancer cells by regulating the PI3K/AKT/mTOR pathway [J]. Journal of Southern Medical University, 2024, 44(8): 1476-1484.
[4]	Shuo LIU, Jing LI, Xingwang WU. Swertiamarin ameliorates 2,4,6-trinitrobenzenesulfonic acid-induced colitis in mice by inhibiting intestinal epithelial cell apoptosis [J]. Journal of Southern Medical University, 2024, 44(8): 1545-1552.
[5]	Shan XIANG, Zongxing ZHANG, Lu JIANG, Daozhong LIU, Weiyi LI, Zhuoma BAO, Rui TIAN, Dan CHENG, Lin YUAN. Tujia medicine Toddalia asiatica improves synovial pannus in rats with collagen-induced arthritis through the PI3K/Akt signaling pathway [J]. Journal of Southern Medical University, 2024, 44(8): 1582-1588.
[6]	Yao CHENG, Yuanying WANG, Feiyang YAO, Pan HU, Mingxian CHEN, Ning WU. Baicalin suppresses type 2 dengue virus-induced autophagy of human umbilical vein endothelial cells by inhibiting the PI3K/AKT pathway [J]. Journal of Southern Medical University, 2024, 44(7): 1272-1283.
[7]	Jincun FANG, Liwei LIU, Junhao LIN, Fengsheng CHEN. Overexpression of CDHR2 inhibits proliferation of breast cancer cells by inhibiting the PI3K/Akt pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1117-1125.
[8]	Lingjun LU, Xiaodi YANG, Huaping ZHANG, Yuan LIANG, Xiulan SHI, Xin ZHOU. Recombinant Schistosoma japonicum cystatin alleviates acute liver injury in mice by inhibiting endoplasmic reticulum stress, inflammation and hepatocyte apoptosis [J]. Journal of Southern Medical University, 2024, 44(6): 1126-1134.
[9]	Yan WANG, Yuqing RUAN, Can CUI, Xiu WANG. Jiaotaiwan improves brain glucose metabolism in a mouse model of Alzheimer's disease by activating the PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 894-903.
[10]	Yuanyuan WANG, Teng CHEN, Xiaofan CONG, Yiran LI, Rui CHEN, Pei ZHANG, Xiaojin SUN, Surong ZHAO. Pristimerin enhances cisplatin-induced apoptosis in nasopharyngeal carcinoma cells via ROS-mediated deactivation of the PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 904-912.
[11]	Yongsheng XIA, Lian WANG, Xiaohua CHEN, Yulu ZHANG, Aofei SUN, Deli CHEN. TSR2 overexpression inhibits proliferation and invasion of gastric cancer cells by downregulating the PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 913-919.
[12]	HE Cheng, CHEN Wei, ZHANG Nianzhi, LUAN Jun, WANG Sanfeng, ZHANG You. Shenqi Chongcao Formula ameliorates inflammatory response in rats with pulmonary fibrosis by activating the ASS1/src/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2024, 44(4): 644-651.
[13]	BAO Hansheng, WANG Sutong, LÜ Mujie, WANG Yongcheng, JIANG Ping, LI Xiao. Activation of α7 nAChR improves white fat homeostasis and promotes beige adipogenesis and thermogenesis in obese mice [J]. Journal of Southern Medical University, 2024, 44(3): 499-506.
[14]	WU Guangyang, SONG Tianli, TANG Lang, WANG Yiming, LIU Xu, HUANG Sheng. Total saponins of Panax japonicus alleviates CCl4-induced acute liver injury in rats by regulating the PI3K/AktNF-κB signaling pathway [J]. Journal of Southern Medical University, 2024, 44(2): 244-251.
[15]	DUAN Ting, ZHANG Zhen, SHI Jinran, XIAO Linyu, YANG Jingjing, YIN Lixia, ZHANG Xiaofeng, GENG Zhijun, LU Guoyu. High expression of CPNE3 correlates with poor long-term prognosis of gastric cancer by inhibiting cell apoptosis via activating PI3K/AKT signaling [J]. Journal of Southern Medical University, 2024, 44(1): 129-137.