miR-143-3p alleviates neuropathic pain in mice with spared nerve injury by targeting the KRAS/RalA pathway and inhibiting astrocyte activation

doi:10.12122/j.issn.1673-4254.2026.05.05

Abstract

Abstract:

Objective To investigate the therapeutic effect of microRNA (miR-143-3p) on neuropathic pain in mice and clarify its target gene and molecular mechanism. Methods Spared nerve injury (SNI) models were established in 8-week-old male C57BL/6J mice, with sham-operated mice as the control group (n=6). The treatment group received a single intrathecal injection of miR-143-3p agomir on day 7 after SNI modeling, and in KRAS agonist group, KRA-533 was intrathecally injected on day 8 following miR-143-3p agomir injection. Mechanical withdrawal thresholds of the ipsilateral paw of the mice were measured using von Frey filaments. Bioinformatics analyses were used to explore the potential targets and signaling pathways. In a C8-D1A astrocyte model of lipopolysaccharide (LPS)-induced inflammation, the effect of miR-143-3p mimic and KRA-533 on the expressions of the identified targets were detected using qRT-PCR and Western blotting. Spinal morphology in the mouse models and proliferative activity of C8-D1A cells were observed with immunofluorescence staining, and the levels of pro-inflammatory factors were determined with enzyme-linked immunosorbent assay (ELISA). Results miR-143-3p agomir significantly increased mechanical withdrawal thresholds of SNI mice, and the effect lasted nearly 3 weeks. KRAS was identified as a direct target of miR-143-3p. In SNI mouse models, miR-143-3p significantly inhibited KRAS expression, RalA/TBK1/NF-κB signaling pathway activation, and astrocyte activation, and upregulated the levels of IL-6, IL-1β, and TNF-α. The KRAS agonist KRA-533 significantly reversed the analgesic effect of miR-143-3p and its inhibitory effects on downstream pathway activation, astrocyte activation, and neuroinflammation. In C8-D1A cells, overexpression of miR-143-3p effectively suppressed LPS-induced noncanonical Ras pathway activation and inhibited cell proliferation and inflammatory response, which were reversed by treatment with KRA-533. Conclusion miR-143-3p overexpression alleviates neuropathic pain in mice by targeting KRAS to regulate the noncanonical Ras pathway and inhibiting astrocyte activation and neuroinflammation, suggesting a new strategy for clinical treatment of SNI.

Key words: neuropathic pain, miR-143-3p, KRAS, astrocytes, neuroinflammation

Yixin LIN, Jinzhong YAO, Yeming CHEN, Zaisheng Qin. miR-143-3p alleviates neuropathic pain in mice with spared nerve injury by targeting the KRAS/RalA pathway and inhibiting astrocyte activation[J]. Journal of Southern Medical University, 2026, 46(5): 1018-1027.

Figures/Tables 7

Tab.1 Primer sequences for qRT-PCR

Genes	Primer sequences (5′-3′)
18S	Forward: AGTCCCTGCCCTTTGTACAC Reverse: CGATCCGAGGGCCTCACTA
DAPK1	Forward: ATGACTGTGTTCAGGCAGGAA Reverse: CCGGTACTTTTCTCACGACATTT
ATG2B	Forward: ATTTGAATATGCTCTCAGTCGCA Reverse: TGAAGTTGGAGGGTTATATCCCA
GABARAPL1	Forward: AGGACCACCCCTTCGAGTATC Reverse: GCACAAGGTACTTCCTCTTATCC
MAPK1	Forward: GGTTGTTCCCAAATGCTGACT Reverse: CAACTTCAATCCTCTTGTGAGGG
NRAS	Forward: GCCTTTTACACACTGGTAAGGG Reverse: CAGCCCCATACAACCTTGAGT
KRAS	Forward: ACATTGGTGAGAGAGATCCGA Reverse: CACAGCCAGGAGTCTTTTCTTC

Fig.1 A single intrathecal injection of miR‐143‐3p alleviates neuropathic pain and suppresses mRNA level of KRAS in mice with spared nerve injury (SNI). A: Experimental protocol of SNI modeling, drug injection and pain behavioral test. B: 50% withdrawal threshold of the left hind paw in mice from different treatment groups at baseline (BL) before and after SNI modeling. C: Venn diagram of miR-143-3p target genes predicted using 3 databases. D, E: Gene ontology (GO) and KEGG pathway enrichment analysis of the target genes using at least 2 databases. F, G: mRNA levels of autophagy-related and Ras signaling-related genes in each group (n=6). ****P<0.0001 vs Sham group; #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs SNI/NC group.

Fig.2 Temporal changes in expression of KRAS after SNI and its targeted regulation by miR-143-3p. A-C: mRNA and protein levels of KRAS in Sham group and on days 3, 7, 14 after SNI modeling. D: Potential binding sequences between miR-143-3p and KRAS 3'UTR in different species. E, F: Protein level of KRAS in each group. *P<0.05, **P<0.01, ***P<0.001 vs Sham group, ####P<0.0001 vs SNI/NC group (n=6).

Fig.3 miR‐143‐3p suppresses neuropathic pain in mice through noncanonical Ras signaling pathway. A: String functional protein-protein interaction (PPI) network of Ras signaling pathway based on miR-143-3p target genes. B: Core modules of the PPI network. C, D: Western blotting of RalA, p-TBK1/TBK1, p-NF-κB/NF-κB in Sham group and on days 3, 7, 14 after SNI modeling. E, F: Western blotting of RalA, p-TBK1/TBK1, and p-NF-κB/NF-κB in each group. *P<0.05, **P<0.01, ****P<0.0001 vs Sham group; #P<0.05, ###P<0.001 vs SNI/NC group (n=6).

Fig.6 KRA-533 reverses analgesic effect of miR-143-3p and its regulatory effects on noncanonical Ras signaling in SNI mice. A, B: Experimental procedure and 50% withdrawal threshold of the left hind paw in mice from different treatment groups at baseline and on days 7, 8, 9, 10, 12, 14, 21, 28, and 35 after SNI modeling. C, D: Western blotting of RalA, p-TBK1/TBK1， and p-NF‑κB/NF‑κB expression in each group. E: Immunofluorescence staining of GFAP (green) in the spinal cord dorsal horn of each group (Scale bar= 50 μm). F: Levels of IL-6， IL-1β and TNF‑α in spinal cord tissues tested by ELISA. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 vs SNI/NC group; #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs SNI/ miR group (n=6).

References 33

[1]	Thouaye M, Yalcin I. Neuropathic pain: From actual pharm-acological treatments to new therapeutic horizons[J]. Pharmacol Ther, 2023, 251: 108546. doi：10.1016/j.pharmthera.2023.108546
[2]	Attal N, Bouhassira D, Colvin L. Advances and challenges in neuropathic pain: a narrative review and future directions[J]. Br J Anaesth, 2023, 131(1): 79-92. doi：10.1016/j.bja.2023.04.021
[3]	Ghazisaeidi S, Muley MM, Salter MW. Neuropathic pain: mechanisms, sex differences, and potential therapies for a global problem[J]. Annu Rev Pharmacol Toxicol, 2023, 63: 565-83. doi：10.1146/annurev-pharmtox-051421-112259
[4]	Soliman N, Moisset X, Ferraro MC, et al. Pharmacotherapy and non-invasive neuromodulation for neuropathic pain: a systematic review and meta-analysis[J]. Lancet Neurol, 2025, 24(5): 413-28. doi：10.1016/S1474-4422(25)00068-7
[5]	Jayathilake NJ, Phan TT, Kim J, et al. Modulating neuroplasticity for chronic pain relief: noninvasive neuromodulation as a promising approach[J]. Exp Mol Med, 2025, 57(3): 501-14. doi：10.1038/s12276-025-01409-0
[6]	Maji RK, Leisegang MS, Boon RA, et al. Revealing microRNA regulation in single cells[J]. Trends Genet, 2025, 41(6): 522-36. doi：10.1016/j.tig.2024.12.009
[7]	Vali R, Azadi A, Tizno A, et al. miRNA contributes to neuropathic pains[J]. Int J Biol Macromol, 2023, 253(Pt 4): 126893. doi：10.1016/j.ijbiomac.2023.126893
[8]	Lu YT, Zhang JT, Zeng FN, et al. Human PMSCs-derived small extracellular vesicles alleviate neuropathic pain through miR-26a-5p/Wnt5a in SNI mice model[J]. J Neuroinflammation, 2022, 19(1): 221. doi：10.1186/s12974-022-02578-9
[9]	Zhu ZH, Xu Y, Wang KJ, et al. The role of astrocyte-derived extracellular vesicles in cellular microenvironment remodeling after spinal cord injury: a study based on quantitative proteomics analysis[J]. Exp Neurol, 2025, 391: 115321. doi：10.1016/j.expneurol.2025.115321
[10]	Zhou DX, Huang Z, Zhu XX, et al. Circular RNA 0025984 ameliorates ischemic stroke injury and protects astrocytes through miR-143-3p/TET1/ORP150 pathway[J]. Mol Neurobiol, 2021, 58(11): 5937-53. doi：10.1007/s12035-021-02486-8
[11]	Ni HD, Xu M, Kuang J, et al. Upregulation of LncRNA71132 in the spinal cord regulates hypersensitivity in a rat model of bone cancer pain[J]. Pain, 2023, 164(1): 180-96. doi：10.1097/j.pain.0000000000002678
[12]	Yuan WX, Liu JQ, Zhang ZZ, et al. Strontium-Alix interaction enhances exosomal miRNA selectively loading in synovial MSCs for temporomandibular joint osteoarthritis treatment[J]. Int J Oral Sci, 2025, 17(1): 6. doi：10.1038/s41368-024-00329-5
[13]	Norcini M, Choi D, Lu H, et al. Intrathecal injection of miR-133b-3p or miR-143-3p prevents the development of persistent cold and mechanical allodynia following a peripheral nerve injury in rats[J]. Neuroscience, 2018, 386: 223-39. doi：10.1016/j.neuroscience.2018.06.040
[14]	Boccella S, Guida F, Palazzo E, et al. Spared nerve injury as a long-lasting model of neuropathic pain[J]. Methods Mol Biol, 2018, 1727: 373-8. doi：10.1007/978-1-4939-7571-6_28
[15]	Hylden JL, Wilcox GL. Intrathecal morphine in mice: a new technique[J]. Eur J Pharmacol, 1980, 67(2/3): 313-6. doi：10.1016/0014-2999(80)90515-4
[16]	Chaplan SR, Bach FW, Pogrel JW, et al. Quantitative assessment of tactile allodynia in the rat paw[J]. J Neurosci Methods, 1994, 53(1): 55-63. doi：10.1016/0165-0270(94)90144-9
[17]	Xu MQ, Ren M, Zhang XY, et al. Mesenchymal stem cell-derived small extracellular vesicles restored nasal barrier function in allergic rhinitis via miR-143-GSK3B in human nasal epithelial cells[J]. J Allergy Clin Immunol, 2025, 155(4): 1236-49.e5. doi：10.1016/j.jaci.2024.10.034
[18]	Xie F, Li C, Zhang XY, et al. miR-143-3p suppresses tumorigenesis in pancreatic ductal adenocarcinoma by targeting KRAS[J]. Biomed Pharmacother, 2019, 119: 109424. doi：10.1016/j.biopha.2019.109424
[19]	Sugito N, Heishima K, Akao Y. Chemically modified MIR143-3p exhibited anti-cancer effects by impairing the KRAS network in colorectal cancer cells[J]. Mol Ther Nucleic Acids, 2022, 30: 49-61. doi：10.1016/j.omtn.2022.09.001
[20]	Zhang F, Cao H. microRNA-143-3p suppresses cell growth and invasion in laryngeal squamous cell carcinoma via targeting the k-Ras/Raf/MEK/ERK signaling pathway[J]. Int J Oncol, 2019, 54(2): 689-701.
[21]	Cronin SJF, Rao S, Tejada MA, et al. Phenotypic drug screen uncovers the metabolic GCH1/BH4 pathway as key regulator of EGFR/KRAS-mediated neuropathic pain and lung cancer[J]. Sci Transl Med, 2022, 14(660): eabj1531. doi：10.1126/scitranslmed.abj1531
[22]	Johnson DS, Chen YH. Ras family of small GTPases in immunity and inflammation[J]. Curr Opin Pharmacol, 2012, 12(4): 458-63. doi：10.1016/j.coph.2012.02.003
[23]	Qiu XT, Zhao FY, He DQ, et al. BQU57 suppresses IL-1β-induced apoptosis and extracellular matrix degradation in nucleus pulposus cells by blocking the NF‑κB signaling pathway[J]. Cell Signal, 2025, 131: 111729. doi：10.1016/j.cellsig.2025.111729
[24]	Magits W, Steklov M, Jang H, et al. K128 ubiquitination constrains RAS activity by expanding its binding interface with GAP proteins[J]. EMBO J, 2024, 43(14): 2862-77. doi：10.1038/s44318-024-00146-w
[25]	Zaman A, Wu XF, Lemoff A, et al. Exocyst protein subnetworks integrate Hippo and mTOR signaling to promote virus detection and cancer[J]. Cell Rep, 2021, 36(5): 109491. doi：10.1016/j.celrep.2021.109491
[26]	Finnerup NB, Kuner R, Jensen TS. Neuropathic pain: from mechanisms to treatment[J]. Physiol Rev, 2021, 101(1): 259-301. doi：10.1152/physrev.00045.2019
[27]	Liu X, Bae C, Gelman BB, et al. A neuron-to-astrocyte Wnt5a signal governs astrogliosis during HIV-associated pain pathogenesis[J]. Brain, 2022, 145(11): 4108-23. doi：10.1093/brain/awac015
[28]	Xu K, Park D, Magis AT, et al. Small molecule KRAS agonist for mutant KRAS cancer therapy[J]. Mol Cancer, 2019, 18(1): 85. doi：10.1186/s12943-019-1012-4
[29]	Zhang ZY, Liu D, Lv R, et al. FBL promotes LPS-induced neuroinflammation by activating the NF-κB signaling pathway[J]. J Inflamm Res, 2024, 17: 2217-31. doi：10.2147/jir.s451049
[30]	Shi W, Zhou Q, Lu L, et al. Copper induced cytosolic escape of mitochondrial DNA and activation of cGAS-STING-NLRP3 pathway-dependent pyroptosis in C8-D1A cells[J]. Ecotoxicol Environ Saf, 2024, 285: 117085. doi：10.1016/j.ecoenv.2024.117085
[31]	Marty-Lombardi S, Lu SY, Ambroziak W, et al. Neuron-astrocyte metabolic coupling facilitates spinal plasticity and maintenance of inflammatory pain[J]. Nat Metab, 2024, 6(3): 494-513. doi：10.1038/s42255-024-01001-2
[32]	Xu J, Yan ZH, Bang SS, et al. GPR37L1 identifies spinal cord astrocytes and protects neuropathic pain after nerve injury[J]. Neuron, 2025, 113(8): 1206-22.e6. doi：10.1016/j.neuron.2025.01.012
[33]	Ju YH, Cho J, Park JY, et al. Tonic excitation by astrocytic GABA causes neuropathic pain by augmenting neuronal activity and glucose metabolism[J]. Exp Mol Med, 2024, 56(5): 1193-205. doi：10.1038/s12276-024-01232-z