Effects of liver fibrosis induced by iron overload on M2 polarization of macrophages in mice

doi:10.12122/j.issn.1673-4254.2025.04.02

Abstract

Abstract:

Objective To observe the evolution of intrahepatic macrophage polarization in mice with liver fibrosis induced by iron overload. Methods Thirty-two C57BL/6 mice (6-8 weeks) were randomized into control group (n=8) and liver fibrosis model group (n=24) induced by aidly intraperitoneal injection of iron dextran. At the 3rd, 5th, and 7th weeks of modeling, 8 mice in the model group were sacrificed for observing liver fibrosis using Masson, Sirius Red and immunohistochemical staining and detecting serum levels of ALT, AST and the levels of serum iron, ferritin, liver total Fe and ferrous Fe. iNOS⁺/F4/80⁺ cells and CD206⁺/F4/80⁺ cells were detected by double immunofluorescence assay to observe the proportion and distribution of M1 and M2 macrophages. The hepatic expressions of Arg-1, iNOS, IL-6, IL-10, and TNF‑α proteins were detected using Western blotting or ELISA, and the expression of CD206 mRNA was detected using RT-PCR. Results The mice in the model group showed gradual increase of fibrous tissue hyperplasia in the portal area over time, structural destruction of the hepatic lobules and formation of pseudolobules. With the passage of time during modeling, the rat models showed significantly increased hepatic expressions of α-SMA and COL-1, elevated serum levels of ALT, AST, Fe, ferritin, and increased liver total Fe and ferrous Fe levels. The expressions of M1 polarization markers IL-6, TNF‑α, and iNOS all increased with time and reached their peak levels at the 3rd week; The expressions of M2 polarization markers (IL-10 and Arg-1 proteins and CD206 mRNA) significantly increased in the 3rd week and but decreased in the 5th and 7th weeks. Conclusion Iron overload promotes M1 polarization of macrophages in mice. Liver fibrosis in the early stage promotes M2 polarization of macrophages but negatively regulate M2 polarization at later stages.

Key words: iron overload, iron dextran, liver fibrosis, macrophage polarization

Jiawen YU, Yi ZHOU, Chunmei QIAN, Lan MU, Renye QUE. Effects of liver fibrosis induced by iron overload on M2 polarization of macrophages in mice[J]. Journal of Southern Medical University, 2025, 45(4): 684-691.

Figures/Tables 12

Tab.1 Primer sequences for RT-qPCR

Gene	Forward primer	Reverse primer
CD206	AGCTTCATCTTCGGGCCTTTG	GGTGACCACTCCTGCTGCTTTAG
β-actin	TTGTAACCAACTGGGACGATATGG	GATCTTGATCTTCATGGTGCTAGG

Fig.1 Histopathological changes of mouse liver with chronic iron overload induced by iron dextran (Original magnification: ×100).

Fig.2 Histopathological changes of mouse liver with chronic iron overload induced by iron dextran. **P<0.01 vs Control.

Fig.3 Changes of α-SMA and COL-1 in mouse liver with chronic iron overload induced by iron dextran (×100).

Fig.4 Changes of α-SMA and COL-1 in mouse liver with chronic iron overload induced by iron dextran. **P<0.01 vs Control.

Fig.5 Changes of liver function in chronic iron overload mice induced by iron dextran. **P<0.01 vs Control.

Fig.6 Changes of serum iron and ferritin contents in chronic iron overload induced by iron dextran.**P<0.01 vs Control.

Fig.7 Changes of total iron and ferrous content in liver with chronic iron overload induced by iron dextran.**P<0.01 vs Control.

Fig.8 Changes of markers of liver macrophage polarization in chronic iron overload induced by iron dextran. A: Changes of M1 polarization markers; B, C: Changes of M2 polarization markers. **P<0.01 vs Control.

Fig.9 Changes in liver macrophage M1 polarization induced by chronic iron overload (×100).

Fig.10 Changes in M2 polarization of liver macrophages in mice with chronic iron overload (×100).

Fig.11 Changes in M1 and M2 polarization of liver macrophages in mice with chronic iron overload. **P<0.01 vs Control.

References 30

1	Suresh D, Li A, Miller MJ, et al. Associations between metabolic hyperferritinaemia, fibrosis-promoting alleles and clinical outcomes in steatotic liver disease[J]. Liver Int, 2024, 44(2): 389-98.
2	Wang C, Ma C, Gong LH, et al. Macrophage polarization and its role in liver disease[J]. Front Immunol, 2021, 12: 803037.
3	Zanganeh S, Hutter G, Spitler R, et al. Iron oxide nanoparticles inhibit tumour growth by inducing pro-inflammatory macrophage polarization in tumour tissues[J]. Nat Nanotechnol, 2016, 11(11): 986-94.
4	Zhou Y, Que KT, Zhang Z, et al. Iron overloaded polarizes macrophage to proinflammation phenotype through ROS/acetyl-p53 pathway[J]. Cancer Med, 2018, 7(8): 4012-22.
5	Handa P, Thomas S, Morgan-Stevenson V, et al. Iron alters macrophage polarization status and leads to steatohepatitis and fibrogenesis[J]. J Leukoc Biol, 2019, 105(5): 1015-26.
6	Dufrusine B, Di Francesco A, Oddi S, et al. Iron-dependent trafficking of 5-lipoxygenase and impact on human macrophage activation[J]. Front Immunol, 2019, 10: 1347.
7	Liu EN, Li Z, Zhang Y, et al. Hepcidin induces M1 macrophage polarization in monocytes or THP-1 derived macrophages[J]. Iran J Immunol, 2019, 16(3): 190-9.
8	Zhang X, Fan LN, Wu JF, et al. Macrophage p38α promotes nutritional steatohepatitis through M1 polarization[J]. J Hepatol, 2019, 71(1): 163-74.
9	Shendge AK, Panja S, Basu T, et al. Ameliorating effects of white mulberry on iron-overload-induced oxidative stress and liver fibro-sis in Swiss albino mice[J]. Food Chem Toxicol, 2021, 156: 112520.
10	Philippe MA, Ruddell RG, Ramm GA. Role of iron in hepatic fibrosis: one piece in the puzzle[J]. World J Gastroenterol, 2007, 13(35): 4746-54.
11	Wood MJ, Gadd VL, Powell LW, et al. Ductular reaction in hereditary hemochromatosis: the link between hepatocyte senesc-ence and fibrosis progression[J]. Hepatology, 2014, 59(3): 848-57.
12	Pietrangelo A. Iron in NASH, chronic liver diseases and HCC: how much iron is too much[J]? J Hepatol, 2009, 50(2): 249-51.
13	Houglum K, Bedossa P, Chojkier M. TGF-beta and collagen-alpha 1 (I) gene expression are increased in hepatic acinar zone 1 of rats with iron overload[J]. Am J Physiol, 1994, 267(5 Pt 1): G908-13.
14	Carthew P, Edwards RE, Smith AG, et al. Rapid induction of hepatic fibrosis in the gerbil after the parenteral administration of iron-dextran complex[J]. Hepatology, 1991, 13(3): 534-9.
15	Ruddell RG, Hoang-Le D, Barwood JM, et al. Ferritin functions as a proinflammatory cytokine via iron-independent protein kinase C Zeta/nuclear factor kappaB-regulated signaling in rat hepatic stellate cells[J]. Hepatology, 2009, 49(3): 887-900.
16	Bridle KR, Crawford DHG, Ramm GA. Identification and characterization of the hepatic stellate cell transferrin receptor[J]. Am J Pathol, 2003, 162(5): 1661-7.
17	Shi HB, Shi HL, Ren F, et al. Naringin in Ganshuang Granule suppresses activation of hepatic stellate cells for anti-fibrosis effect by inhibition of mammalian target of rapamycin[J]. J Cell Mol Med, 2017, 21(3): 500-9.
18	Kraml P. The role of iron in the pathogenesis of atherosclerosis[J]. Physiol Res, 2017, 66(): S55-67.
19	Mesquita G, Silva T, Gomes AC, et al. H-Ferritin is essential for macrophages' capacity to store or detoxify exogenously added iron[J]. Sci Rep, 2020, 10(1): 3061.
20	Gan ZS, Wang QQ, Li JH, et al. Iron reduces M1 macrophage polarization in RAW_264.7 macrophages associated with inhibition of STAT1[J]. Mediators Inflamm, 2017, 2017: 8570818.
21	Ward RJ, Wilmet S, Legssyer R, et al. Effects of marginal iron overload on iron homeostasis and immune function in alveolar macrophages isolated from pregnant and normal rats[J]. Biometals, 2009, 22(2): 211-23.
22	Lee CJ, Jeong H, Bae Y, et al. Targeting of M2-like tumor-associated macrophages with a melittin-based pro-apoptotic peptide[J]. J Immunother Cancer, 2019, 7(1): 147.
23	Kao JK, Wang SC, Ho LW, et al. M2-like polarization of THP-1 monocyte-derived macrophages under chronic iron overload[J]. Ann Hematol, 2020, 99(3): 431-41.
24	Kroner A, Greenhalgh AD, Zarruk JG, et al. TNF and increased intracellular iron alter macrophage polarization to a detrimental M1 phenotype in the injured spinal cord[J]. Neuron, 2014, 83(5): 1098-116.
25	Sumitomo R, Hirai T, Fujita M, et al. M2 tumor-associated macrophages promote tumor progression in non-small-cell lung cancer[J]. Exp Ther Med, 2019, 18(6): 4490-8.
26	Harhaji L, Vuckovic O, Miljkovic D, et al. Iron down-regulates macrophage anti-tumour activity by blocking nitric oxide production[J]. Clin Exp Immunol, 2004, 137(1): 109-16.
27	Yamaguchi T, Fushida S, Yamamoto Y, et al. Tumor-associated macrophages of the M2 phenotype contribute to progression in gastric cancer with peritoneal dissemination[J]. Gastric Cancer, 2016, 19(4): 1052-65.
28	Hoeft K, Bloch DB, Graw JA, et al. Iron loading exaggerates the inflammatory response to the toll-like receptor 4 ligand lipopo-lysaccharide by altering mitochondrial homeostasis[J]. Anesthesiology, 2017, 127(1): 121-35.
29	Sindrilaru A, Peters T, Wieschalka S, et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice[J]. J Clin Invest, 2011, 121(3): 985-97.
30	Agoro R, Taleb M, Quesniaux VFJ, et al. Cell iron status influences macrophage polarization[J]. PLoS One, 2018, 13(5): e0196921.

[1]	Yuming ZHANG, Shicheng XIA, Linlin ZHANG, Mengxi CHEN, Xiaojing LIU, Qin GAO, Hongwei YE. Protective effect of Lonicerae japonicae flos extract against doxorubicin-induced liver injury in mice [J]. Journal of Southern Medical University, 2024, 44(8): 1571-1581.
[2]	CAO Jiafan, SUN Yue, DING Xin, LI Shengwen, CHEN Bo, LAN Tian. Arbutin ameliorates liver fibrosis in mice by inhibiting macrophage recruitment and regulating the Akt/NF-κB and Smad signaling pathways [J]. Journal of Southern Medical University, 2024, 44(4): 652-659.
[3]	XU Xiaohui, FENG Jinmei, LUO Ying, HE Xinyu, ZANG Jinbao, HUANG Daochao. Adeno-associated virus-mediated hepatocyte-specific NDUFA13 overexpression protects against CCl4-induced liver fibrosis in mice by inhibiting hepatic NLRP3 activation [J]. Journal of Southern Medical University, 2024, 44(2): 201-209.
[4]	Wen ZHAO, Hejing RUAN, Siyuan WANG, Yuzhe CHENG, Miao LEI, Jiufa ZHAO, Chuanmiao LIU. Inhibiting Yes-associated protein alleviates CCl₄ liver fibrosis in mice by reducing epithelial mesenchymal transition [J]. Journal of Southern Medical University, 2024, 44(10): 1839-1849.
[5]	LIN Jiayi, LOU Anni, LI Xu. Lipopolysaccharide stimulates macrophages to secrete exosomes containing miR-155-5p to promote activation and migration of hepatic stellate cells [J]. Journal of Southern Medical University, 2023, 43(6): 994-1001.
[6]	LI jingyi, YANG Siyuan, HAN Zhen, JIANG Tianle, ZHU Yao, ZHOU Zihang, ZHOU Jingping. Akt2 inhibitor promotes M2 macrophage polarization in rats with periapical inflammation by reducing miR-155-5p expression [J]. Journal of Southern Medical University, 2023, 43(4): 568-576.
[7]	ZHANG Mengying, LI Zhi, PEI Weiya, LI Xueqin, YANG Hui, ZHU Xiaolong, LÜ Kun. M2 macrophage-derived exosomal lncRNA NR_028113.1 promotes macrophage polarization possibly by activating the JAK2/STAT3 signaling pathway [J]. Journal of Southern Medical University, 2023, 43(3): 393-399.
[8]	YANG Xuejia, LI Yujie, WU Dengqiang, MA Yili, ZHOU Sufang. Screening and identification of key genes ATP1B3 and ENAH in the progression of hepatocellular carcinoma: based on data mining and clinical validation [J]. Journal of Southern Medical University, 2022, 42(6): 815-823.
[9]	DENG Ya, WANG Chunyan, FU Yiming, LI Zhongbin, JI Dong. A high relapse risk of chronic drug-induced liver injury is correlated with a greater severity of liver fibrosis [J]. Journal of Southern Medical University, 2022, 42(11): 1655-1661.
[10]	ZHAO Chenling, DONG Ting, SUN Lunyan, HU Huibing, WANG Qiong, TIAN Liwei, JIANG Zhangsheng. Establishment and validation of a predictive nomogram for liver fibrosis in patients with Wilson disease and abnormal lipid metabolism [J]. Journal of Southern Medical University, 2022, 42(11): 1720-1725.
[11]	ZHAO Zhibin, DONG Hui, LI Binghang, SHEN Bo, GUO Yuecheng, GU Tianyi, QU Ying, CAI Xiaobo, LU Lungen. Hydroxynitone suppresses hepatic stellate cell activation by inhibiting TGF-β1 phosphorylation to alleviate CCl₄-induced liver fibrosis in rats [J]. Journal of Southern Medical University, 2022, 42(10): 1511-1516.
[12]	ZHANG Chunyan, YAN Yuxin, GAO Xiaoyang, MA Yuehong. Therapeutic mechanism of the Mongolian medicine Qiwei Qinggan Powder against liver fibrosis based on UHPLC-TOF-MS combined with network pharmacological methods [J]. Journal of Southern Medical University, 2021, 41(8): 1131-1141.
[13]	. Baoganning formula alleviates liver fibrosis in mice by inhibiting hepatic IDO1 expression and promoting phenotypic maturation of dendritic cells [J]. Journal of Southern Medical University, 2021, 41(7): 1002-1011.
[14]	. Inhibitory effect of Xinhui citrus fermentation liquor on liver fibrosis in mice [J]. Journal of Southern Medical University, 2021, 41(4): 588-592.
[15]	. Amentoflavone inhibits M1 polarization of THP-1-derived foam cells by activating PPAR-α/γ [J]. Journal of Southern Medical University, 2021, 41(3): 344-351.