METTL3-mediated m6A modification promotes FOXO3 expression and anthracycline resistance in acute myeloid leukemia cells through autophagy regulation

doi:10.12122/j.issn.1673-4254.2025.03.04

Abstract

Abstract:

Objective To investigate the role of METTL3 and FOXO3 in anthracycline resistance in acute myeloid leukemia (AML) cells. Methods Methylated RNA immunoprecipitation sequencing (MeRIP-seq) and transcriptome sequencing (RNA-seq) were performed in anthracycline-resistant and sensitive HL60 and K562 cells with lentivirus-mediated knockdown or overexpression of METTL3 and FOXO3. TCGA and GSE6891 datasets were used for analysis of the clinical and gene expression data of AMI patients. FOXO3 expressions at the mRNA and protein levels in the transfected cells were detected with RT-qPCR and Western blotting, and the changes in cell proliferation and apoptosis were evaluated using CCK8 assay and flow cytometry; the expression of m⁶A-modified mRNA and mRNA stability of FOXO3 was detected analyzed using MeRIP-qPCR and RT-qPCR. Functional enrichment analysis of the differential genes in the transfected cells was performed. Results Differential gene analysis in anthracycline-resistant versus sensitive AML cells and in cells with METTL3 knockdown revealed the enrichment in FoxO and autophagy pathways (P<0.05), and the anthracycline-resistant cells showed significantly increased m⁶A modification of FOXO3. FOXO3 expression was positively correlated with METTL3 expression. METTL3 knockdown significantly reduced FOXO3 mRNA stability and its protein levels in anthracycline-resistant AML cells, which exhibited higher m6A-modified FOXO3 expression levels than their sensitive counterparts. Database analysis, Kaplan-Meier analysis and RT-qPCR results suggested that a high FOXO3 expression was associated with a poor prognosis of AML patients. In anthracycline-resistant AML cells expressing higher FOXO3 levels than the sensitive cells, lentivirus-mediated overexpression of FOXO3 significantly enhanced cell proliferation and suppressed cell apoptosis. Inhibiting autophagy using an autophagy inhibitor (Baf.A1) obviously enhanced the inhibitory effect of adriamycin on resistant AMI cells and cells overexpressing FOXO3. Conclusion METTL3 promotes FOXO3 expression via m6A modification, and FOXO3-driven autophagy contributes to anthracycline resistance in AML cells by enhancing cell proliferation and suppressing cell apoptosis.

Key words: acute myeloid leukemia, chemotherapy resistance, FOXO3, METTL3, RNA methylation

Xiawei ZHANG, Jingjing YANG, Yanan WEN, Qingyang LIU, Liping DOU, Chunji GAO. METTL3-mediated m⁶A modification promotes FOXO3 expression and anthracycline resistance in acute myeloid leukemia cells through autophagy regulation[J]. Journal of Southern Medical University, 2025, 45(3): 470-478.

Figures/Tables 7

Tab.1 Primer sequence of RT-qPCR

Gene	Forward primers sequences	Reverse primers sequences
METTL3	ATCCCCAAGGCTTCAACCAG	GCGAGTGCCAGGAGATAGTC
FOXO3	CGGACAAACGGCTCACTCT	GGACCCGCATGAATCGACTAT
GAPDH	GGAGCGAGATCCCTCCAAAAT	GGCTGTTGTCATACTTCTCATGG

Fig.1 Sequencing analysis of AML cells. A: KEGG enrichment analysis of differential genes in HL60 cells and HL60/ADR cells. B: KEGG enrichment analysis of differential genes in K562/ADR sh-METTL3 cells and K562/ADR sh-con cells. C: MeRIP-seq methylation modification peak analysis in HL60 cells and HL60/ADR cells.

Fig.2 Correlation of METTL3 with FOXO3 expression. A: Correlation analysis of METTL3 and FOXO3 expression in 163 AML patients from TCGA. B: RT-qPCR analysis of FOXO3 expression in sh-METTL3 cells and sh-con cells. C, D: Western blotting of FOXO3 levels in sh-con cells and sh-METTL3 cells. E: RT-qPCR analysis of FOXO3 expression in OE-METTL3 cells and OE-con cells. F, G: Western blotting of FOXO3 levels in OE-con cells and OE-METTL3. ADR: Adriamycin; sh-con: control shRNA; sh-METTL3: METTL3 shRNA; OE-con: overexpressed control RNA; OE-METTL3: METTL3 overexpression. *P<0.05, **P<0.01, ****P<0.0001.

Fig.3 METTL3-mediated m6A modification enhances stability of FOXO3 mRNA. A: MeRIP-qPCR for detecting expression levels of m6A-modified FOXO3 mRNA in anthracycline-resistant cells and anthracycline-sensitive cells. B: MeRIP-qPCR for detecting expression levels of m6A-modified FOXO3 mRNA in OE-con and OE-METTL3 K562/ADR cells. C: RNA stability assay of FOXO3 mRNA in sh-con vs sh-METTL3 groups. *P<0.05, **P<0.01, ***P<0.001.

Tab.2 Clinical characteristics of patients in TCGA and GSE6891 databases

Characteristics	TCGA		GSE6891
Characteristics	n	%	n	%
Age [year, median (range)]	58 (18-88)	-	49 (15-60)	-
Gender
Female	76	46.6	213	49.0
Male	87	53.4	222	51.0
FAB classification
M0	16	9.8	16	3.7
M1	44	27.0	94	21.6
M2	40	24.5	105	24.1
M3	-	-	1	0.2
M4	35	21.5	84	19.3
M5	21	12.9	103	23.7
M6	2	1.2	6	1.4
M7	3	1.8	1	0.2
Unkown	2	1.2	25	5.7
Cytogenetic risk classification
Favorable	18	11.0	75	17.2
Intermediate	92	56.4	258	59.3
Poor	50	30.7	92	21.1
Unknown	3	1.8	10	2.3

Fig.4 High FOXO3 expression suggests poor prognosis for patients. A: Analysis of FOXO3 expression levels stratified by cytogenetic prognosis in GSE6891 datasets. B: Survival analysis of 160 AML patients in TCGA. C: RT-qPCR analysis of FOXO3 expression in AML patients. D, E: RT-qPCR (D) and Western blotting (E) of FOXO3 expression in anthracycline-sensitive cells and anthracycline-resistant cells. F, G: RT-qPCR (F) and Western blotting (G) of FOXO3 expression in OE-con and OE-FOXO3 K562/ADR cells. H: Cell proliferation and apoptosis analysis of FOXO3-overexpressing cells. *P<0.05, **P<0.01.

Fig.5 FOXO3 affects anthracycline resistance of AML cells by regulating autophagy. A: GO enrichment analysis in HL60 and HL60/ADR cells. B: GO enrichment analysis in sh-con cells and sh-METTL3 cells. C: Western blotting of autophagy flow in K562 cells and K562/ADR cells. D: Western blotting of autophagy flow in OE-con cells and OE-FOXO3 cells. E: Proliferation analysis of K562/ADR cells treated with Baf.A1 (100 nmol/L) for 72 h. F: Proliferation analysis of OE-FOXO3 cells treated with ADR and Baf.A1 (10 nmol/L) for 72 h. **P<0.01, ***P<0.001.

References 35

1	Bhansali RS, Pratz KW, Lai C. Recent advances in targeted therapies in acute myeloid leukemia[J]. J Hematol Oncol, 2023, 16(1): 29.
2	Pollyea DA, Altman JK, Assi R, et al. Acute myeloid leukemia, version 3.2023, NCCN clinical practice guidelines in oncology[J]. J Natl Compr Canc Netw, 2023, 21(5): 503-13.
3	Thol F, Ganser A. Treatment of relapsed acute myeloid leukemia[J]. Curr Treat Options Oncol, 2020, 21(8): 66.
4	DiNardo CD, Erba HP, Freeman SD, et al. Acute myeloid leukaemia[J]. Lancet, 2023, 401(10393): 2073-86.
5	Stelmach P, Trumpp A. Leukemic stem cells and therapy resistance in acute myeloid leukemia[J]. Haematologica, 2023, 108(2): 353-66.
6	An YY, Duan H. The role of m6A RNA methylation in cancer metabolism[J]. Mol Cancer, 2022, 21(1): 14.
7	Vu LP, Pickering BF, Cheng YM, et al. The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells[J]. Nat Med, 2017, 23(11): 1369-76.
8	Hornsveld M, Dansen TB, Derksen PW, et al. Re-evaluating the role of FOXOs in cancer[J]. Semin Cancer Biol, 2018, 50: 90-100.
9	Farhan M, Silva M, Li S, et al. The role of FOXOs and autophagy in cancer and metastasis-Implications in therapeutic development[J]. Med Res Rev, 2020, 40(6): 2089-113.
10	Naka K, Hoshii T, Muraguchi T, et al. TGF-beta-FOXO signalling maintains leukaemia-initiating cells in chronic myeloid leukaemia[J]. Nature, 2010, 463(7281): 676-80.
11	Chakrabarty A, Bhola NE, Sutton C, et al. Trastuzumab-resistant cells rely on a HER2-PI3K-FoxO-survivin axis and are sensitive to PI3K inhibitors[J]. Cancer Res, 2013, 73(3): 1190-200.
12	Yu C, Chen DQ, Liu HX, et al. Rosmarinic acid reduces the resistance of gastric carcinoma cells to 5-fluorouracil by downregul-ating FOXO4-targeting miR-6785-5p[J]. Biomed Pharmacother, 2019, 109: 2327-34.
13	Niu JF, Yan TQ, Guo W, et al. The COPS3-FOXO3 positive feedback loop regulates autophagy to promote cisplatin resistance in osteosarcoma[J]. Autophagy, 2023, 19(6): 1693-710.
14	Lin ZY, Niu Y, Wan A, et al. RNA m6 A methylation regulates sorafenib resistance in liver cancer through FOXO3‑mediated autophagy[J]. EMBO J, 2020, 39(12): e103181.
15	Santamaría CM, Chillón MC, García-Sanz R, et al. High FOXO3a expression is associated with a poorer prognosis in AML with normal cytogenetics[J]. Leuk Res, 2009, 33(12): 1706-9.
16	Chen Z, Guo Q, Huang SC, et al. Overcoming adaptive resistance in AML by synergistically targeting FOXO3A-GNG7-mTOR axis with FOXO3A inhibitor Gardenoside and rapamycin[J]. Genes Dis, 2023, 11(1): 397-412.
17	中华医学会血液学分会白血病淋巴瘤学组. 中国成人急性髓系白血病(非急性早幼粒细胞白血病)诊疗指南(2021年版)[J]. 中华血液学杂志, 2021, 42(8): 617-23.
18	Zhuang HZ, Yu B, Tao D, et al. The role of m6A methylation in therapy resistance in cancer[J]. Mol Cancer, 2023, 22(1): 91.
19	Boulias K, Greer EL. Biological roles of adenine methylation in RNA[J]. Nat Rev Genet, 2023, 24(3): 143-60.
20	Zheng X, Gong YP. Functions of RNA N6-methyladenosine modification in acute myeloid leukemia[J]. Biomark Res, 2021, 9(1): 36.
21	Hong YG, Yang ZG, Chen Y, et al. The RNA m6A reader YTHDF1 is required for acute myeloid leukemia progression[J]. Cancer Res, 2023, 83(6): 845-60.
22	Cheng Y, Gao ZY, Zhang TT, et al. Decoding m6A RNA methylome identifies PRMT6-regulated lipid transport promoting AML stem cell maintenance[J]. Cell Stem Cell, 2023, 30(1): 69-85. e7.
23	Li MY, Ye JJ, Xia Y, et al. METTL3 mediates chemoresistance by enhancing AML homing and engraftment via ITGA4[J]. Leukemia, 2022, 36(11): 2586-95.
24	Fang S, Peng B, Wen YN, et al. Transcriptome-wide analysis of RNA N6-methyladenosine modification in adriamycin-resistant acute myeloid leukemia cells[J]. Front Genet, 2022, 13: 833694.
25	Xu YQ, Song M, Hong ZY, et al. The N6-methyladenosine METTL3 regulates tumorigenesis and glycolysis by mediating m6A methylation of the tumor suppressor LATS1 in breast cancer[J]. J Exp Clin Cancer Res, 2023, 42(1): 10.
26	Yin H, Chen L, Piao SQ, et al. M6A RNA methylation-mediated RMRP stability renders proliferation and progression of non-small cell lung cancer through regulating TGFBR1/SMAD2/SMAD3 pathway[J]. Cell Death Differ, 2023, 30(3): 605-17.
27	Orea-Soufi A, Paik J, Bragança J, et al. FOXO transcription factors as therapeutic targets in human diseases[J]. Trends Pharmacol Sci, 2022, 43(12): 1070-84.
28	Rodriguez-Colman MJ, Dansen TB, Burgering BMT. FOXO transcription factors as mediators of stress adaptation[J]. Nat Rev Mol Cell Biol, 2024, 25(1): 46-64.
29	Eijkelenboom A, Burgering BMT. FOXOs: signalling integrators for homeostasis maintenance[J]. Nat Rev Mol Cell Biol, 2013, 14(2): 83-97.
30	van der Horst A, Burgering BMT. Stressing the role of FoxO proteins in lifespan and disease[J]. Nat Rev Mol Cell Biol, 2007, 8(6): 440-50.
31	Long J, Jia MY, Fang WY, et al. FLT3 inhibition upregulates HDAC8 via FOXO to inactivate p53 and promote maintenance of FLT3-ITD+ acute myeloid leukemia[J]. Blood, 2020, 135(17): 1472-83.
32	Kornblau SM, Singh N, Qiu YH, et al. Highly phosphorylated FOXO3A is an adverse prognostic factor in acute myeloid leukemia[J]. Clin Cancer Res, 2010, 16(6): 1865-74.
33	Debnath J, Gammoh N, Ryan KM. Autophagy and autophagy-related pathways in cancer[J]. Nat Rev Mol Cell Biol, 2023, 24(8): 560-75.
34	Luo YH, Zheng ST, Wu QY, et al. Long noncoding RNA (lncRNA) EIF3J-DT induces chemoresistance of gastric cancer via autophagy activation[J]. Autophagy, 2021, 17(12): 4083-101.
35	Warr MR, Binnewies M, Flach J, et al. FOXO3A directs a protective autophagy program in haematopoietic stem cells[J]. Nature, 2013, 494(7437): 323-7.

[1]	Yue DU, Xiusen ZHANG, Kexu ZHOU, Xing JIN, Xiang YUAN, Shegan GAO. RgpB contributes to chemoresistance in esophageal squamous cell carcinoma by preventing Cx43 degradation via inhibiting autophagosome-lysosome fusion [J]. Journal of Southern Medical University, 2024, 44(9): 1670-1676.
[2]	CHEN Xing, WANG Kaiwan, CHU Dehai, ZHU Yu, ZHANG Wenbing, CAO Huiping, XIE Wenyu, LU Chuanhao, LI Xia. Forsythiaside B inhibits cerebral ischemia/reperfusion-induced oxidative stress injury in mice via the AMPK/DAF-16/FOXO3 pathway [J]. Journal of Southern Medical University, 2023, 43(2): 199-205.
[3]	GAO Yinan, WANG Peijun, LU Sumei, MA Wanshan. METTL3 inhibitor STM2457 improves metabolic dysfunction-associated fatty liver disease by regulating mitochondrial function in mice [J]. Journal of Southern Medical University, 2023, 43(10): 1689-1696.
[4]	WEN Yanan, FANG Shu, YANG Jingjing, WANG Hao, JIAO Yifan, WANG Nan, WEI Yan, WANG Lili, DOU Liping. Characteristics of N6-methyladenosine modification patterns in t(8;21) acute myeloid leukemia [J]. Journal of Southern Medical University, 2022, 42(5): 690-697.
[5]	ZHANG Xiaoning, ZHANG Xiaoyu, LIU Peng, LIU Kuo, LI Wenwen, CHEN Qianqian, MA Wanshan. Prognostic implications and functional enrichment analysis of LTB4R in patients with acute myeloid leukemia [J]. Journal of Southern Medical University, 2022, 42(3): 309-320.
[6]	HAO Yanmei, JI Junli, LIU Chunyi, ZHANG Nan, GONG Yajuan. Effects of matrine combined with LY294002 on proliferation, apoptosis and cell cycle of human myeloid leukemia K562 cells [J]. Journal of Southern Medical University, 2022, 42(11): 1739-1746.
[7]	. RUNX1 gene mutations are associated with adverse prognosis of patients with acute myeloidleukemia [J]. Journal of Southern Medical University, 2020, 40(11): 1601-1606.
[8]	. Analysis of immunophenotypes and expressions of non-myeloid antigens in acute myeloid leukemia [J]. Journal of Southern Medical University, 2020, 40(11): 1639-1644.
[9]	. Effect of Foxo3a gene over-expression on the development of rat ovarian granulose cells and in prevention of cisplatin-induced ovarian damage in rats [J]. Journal of Southern Medical University, 2016, 36(06): 796-.
[10]	. Expressions of CDX2 and β-catenin and their correlation in acute myeloid leukemia [J]. Journal of Southern Medical University, 2015, 35(05): 728-.

METTL3-mediated m⁶A modification promotes FOXO3 expression and anthracycline resistance in acute myeloid leukemia cells through autophagy regulation

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 35

Related Articles 10

Recommended Articles

Metrics

Comments