Ferroptosis suppressor genes are highly expressed in esophageal cancer to inhibit tumor cell ferroptosis

doi:10.12122/j.issn.1673-4254.2024.07.19

Abstract

Abstract:

Objective To explore the role of ferroptosis-related genes in regulating ferroptosis of esophageal squamous cell carcinoma (ESCC). Methods ESCC datasets GSE161533 and GSE20347 were downloaded from the Gene Expression Omnibus (GEO) to identify the differentially expressed genes (DEGs) using R software. ESCC ferroptosis-related genes obtained by intersecting the DEGs with ferroptosis-related genes from FerrDb were analyzed using GO and KEGG analyses, protein-protein interaction (PPI) network analysis, and core gene identification through Cytoscape. The identified ferroptosis suppressor genes were validated using TCGA database, and their expression levels were detected using RT-qPCR in cultured normal esophageal cells and ESCC cells. Six ferroptosis suppressor genes (RRM2, GCLC, TFRC, TXN, SLC7A11, and EZH2) were downregulated with siRNA in ESCC cells, and the changes in cell proliferation and apoptosis were assessed with CCK8 assay and flow cytometry; Western blotting was performed to examine the changes in ferroptosis progression of the cells. Results We identified a total of 58 ESCC ferroptosis-related genes, which involved such biological processes as glutathione transmembrane transport, iron ion transport, and apoptosis and the ferroptosis, glutathione metabolism, and antifolate resistance pathways. The PPI network included 54 nodes and 74 edges with a clustering coefficient of 0.522 and PPI enrichment P<0.001. Cytoscape identified 6 core ferroptosis suppressor genes (RRM2, TFRC, TXN, EZH2, SLC7A11, and GCLC), which were highly expressed in ESCC tissues in the TCGA dataset and in ESCC cell lines. Downregulating these genes in ESCC TE1 cells significantly inhibited cell proliferation, promoted cell apoptosis, reduced the expression levels of ferroptosis markers GPX4 and FIH1, and increased the expression of ACSL4. Conclusion High expression of ferroptosis suppressor genes in ESCC may cause arrest of ferroptosis progression to facilitate tumor development, and inhibiting these genes can restore ferroptosis and promote cell apoptosis, suggesting their value as potential therapeutic targets for ESCC.

Key words: esophageal squamous cell carcinoma, ferroptosis, apoptosis

Yuanguo WANG, Peng ZHANG. Ferroptosis suppressor genes are highly expressed in esophageal cancer to inhibit tumor cell ferroptosis[J]. Journal of Southern Medical University, 2024, 44(7): 1389-1396.

Figures/Tables 7

Tab.1 Sequences of the primers for the ferroptosis suppressor genes and GAPDH

Primer	Primer sequence (5'-3')	Product length (bp)
RRM2	Forward Primer:GAACTTATTAGCAGAGATGAGG Reverse Primer:TTCTATCCGAACAGCATTGA	123
GCLC	Forward Primer:TCTCCAGGTGACATTCCAA Reverse Primer:TGACACATAGCCTCGGTAA	127
TFRC	Forward Primer:CTTCCTTCAATCACACTCAG Reverse Primer:ACAGTCTCCTTCCATATTCC	119
TXN	Forward Primer:AGCAGATCGAGAGCAAGA Reverse Primer:GAAGCAACATCCTGACAGT	193
SLC7A11	Forward Primer:CCTGTTGTGTCCACCATC Reverse Primer:AAGATTCCTGCTCCAATGAT	176
EZH2	Forward Primer:AAGGATACAGACAGTGATAGG Reverse Primer:ACATTCTCAGGAGGTTCAAT	164
GAPDH	Forward Primer:GAAGGTGAAGGTCGGAGTC Reverse Primer:GGGTGGAATCATATTGGAAC	152

Fig.1 Volcano map of the DEGs. Blue color represents the downregulated genes (log2FC<-1.0, P<0.05) and red the upregulated genes (log2FC>1.0, P<0.05) in GSE20347 and GSE161533 datasets.

Fig.2 Venn diagram of GSE161533 and GSE20347 DEGs and ferroptosis genes.

Fig.3 GO and KEGG functional enrichment map and PPI network map. A: Bubble diagram of GO analysis of BP, MF and CC functions. B: Bubble diagram of KEGG analysis of the main signaling pathways. C: PPI network (red indicates up-regulated and green down-regulated genes). D: Core gene network diagram screened by the "Degree" module.

Fig.4 Expression levels of 6 ferroptosis suppressor genes in TCGA esophageal cancer dataset. **P<0.01, ***P<0.001.

Fig.5 Expression levels of 6 ferroptosis suppressor genes in different esophageal cancer cell line. *P<0.05, **P<0.01, ***P<0.001.

Fig.6 Effect of ferroptosis suppressor gene knock-down on proliferation and apoptosis of esophageal carcinoma cells. A, B: Effect of knocking down ferroptosis suppressor genes on TE1 cell apoptosis and proliferation. C-F: Effect of knocking down ferroptosis suppressor genes on GPX4, FIH1 and ACSL4 proteins. *P<0.05 vs Control and Negative group.

References 33

1	Short MW, Burgers KG, Fry VT. Esophageal cancer[J]. Am Fam Physician, 2017, 95(1): 22-8.
2	Liu Y, Ge QQ, Xu SN, et al. Efficacy and safety of anlotinib plus programmed death-1 blockade versus anlotinib monotherapy as second or further-line treatment in advanced esophageal squamous cell carcinoma: a retrospective study[J]. Front Oncol, 2022, 12: 942678.
3	Hong T, Lei G, Chen X, et al. PARP inhibition promotes ferroptosis via repressing SLC7A11 and synergizes with ferroptosis inducers in BRCA-proficient ovarian cancer[J]. Redox Biol, 2021, 42: 101928.
4	Cheng Q, Bao LJ, Li MQ, et al. Erastin synergizes with cisplatin via ferroptosis to inhibit ovarian cancer growth in vitro and in vivo [J]. J Obstet Gynaecol Res, 2021, 47(7): 2481-91.
5	Yin LZ, Liu PY, Jin Y, et al. Ferroptosis-related small-molecule compounds in cancer therapy: strategies and applications[J]. Eur J Med Chem, 2022, 244: 114861.
6	Guo JP, Xu BF, Han Q, et al. Ferroptosis: a novel anti-tumor action for cisplatin[J]. Cancer Res Treat, 2018, 50(2): 445-60.
7	Tao H, Song SJ, Fan ZW, et al. PKCiota inhibits the ferroptosis of esophageal cancer cells via suppressing USP14-mediated autophagic degradation of GPX4[J]. Antioxidants, 2024, 13(1): 114.
8	Fan X, Fan YT, Zeng H, et al. Role of ferroptosis in esophageal cancer and corresponding immunotherapy[J]. World J Gastrointest Oncol, 2023, 15(7): 1105-18.
9	Shishido Y, Amisaki M, Matsumi Y, et al. Antitumor effect of 5-aminolevulinic acid through ferroptosis in esophageal squamous cell carcinoma[J]. Ann Surg Oncol, 2021, 28(7): 3996-4006.
10	Jiang B, Zhao YQ, Shi M, et al. DNAJB6 promotes ferroptosis in esophageal squamous cell carcinoma[J]. Dig Dis Sci, 2020, 65(7): 1999-2008.
11	Maimaitizunong R, Wang K, Li H. Ferroptosis and its emerging role in esophageal cancer[J]. Front Mol Biosci, 2022, 9: 1027912.
12	Yao WJ, Wang JJ, Meng FR, et al. Circular RNA CircPVT1 inhibits 5-fluorouracil chemosensitivity by regulating ferroptosis through miR-30a-5p/FZD3 axis in esophageal cancer cells[J]. Front Oncol, 2021, 11: 780938.
13	Zhang JH, Wang N, Zhou YY, et al. Oridonin induces ferroptosis by inhibiting gamma-glutamyl cycle in TE1 cells[J]. Phytother Res, 2021, 35(1): 494-503.
14	Yang RY, Chen FZ, Xu HZ, et al. Exploring the mechanism of realgar against esophageal cancer based on ferroptosis induced by ROS-ASK1-p38 MAPK signaling pathway[J]. Evid Based Complement Alternat Med, 2022: 3698772.
15	Yin LB, Li ZW, Wang JL, et al. Sulfasalazine inhibits esophageal cancer cell proliferation by mediating ferroptosis[J]. Chem Biol Drug Des, 2023, 102(4): 730-7.
16	Xia Y, Tang YX, Huang ZX, et al. Artesunate-loaded solid lipid nanoparticles resist esophageal squamous cell carcinoma by inducing Ferroptosis through inhibiting the AKT/mTOR signaling[J]. Cell Signal, 2024, 117: 111108.
17	Niu BY, Liao KX, Zhou YX, et al. Application of glutathione depletion in cancer therapy: enhanced ROS-based therapy, ferroptosis, and chemotherapy[J]. Biomaterials, 2021, 277: 121110.
18	Criscuolo D, Avolio R, Parri M, et al. Decreased levels of GSH are associated with platinum resistance in high-grade serous ovarian cancer[J]. Antioxidants, 2022, 11(8): 1544.
19	Wang SF, Chang YL, Fang WL, et al. Growth differentiation factor 15 induces cisplatin resistance through upregulation of xCT expression and glutathione synthesis in gastric cancer[J]. Cancer Sci, 2023, 114(8): 3301-17.
20	Xu R, Wang WN, Zhang WL. Ferroptosis and the bidirectional regulatory factor p53[J]. Cell Death Discov, 2023, 9(1): 197.
21	Chu B, Kon N, Chen DL, et al. ALOX12 is required for p53-mediated tumour suppression through a distinct ferroptosis pathway[J]. Nat Cell Biol, 2019, 21(5): 579-91.
22	Yi JM, Zhu JJ, Wu J, et al. Oncogenic activation of PI3K-AKT-mTOR signaling suppresses ferroptosis via SREBP-mediated lipogenesis[J]. Proc Natl Acad Sci USA, 2020, 117(49): 31189-97.
23	Lei G, Zhuang L, Gan BY. mTORC1 and ferroptosis: regulatory mechanisms and therapeutic potential[J]. Bioessays, 2021, 43(8): e2100093.
24	Zhang YL, Swanda RV, Nie LT, et al. mTORC1 couples cyst(e)ine availability with GPX4 protein synthesis and ferroptosis regulation[J]. Nat Commun, 2021, 12(1): 1589.
25	Ma SM, Dielschneider RF, Henson ES, et al. Ferroptosis and autophagy induced cell death occur independently after siramesine and lapatinib treatment in breast cancer cells[J]. PLoS One, 2017, 12(8): e0182921.
26	Man SL, Luo C, Yan MY, et al. Treatment for liver cancer: from sorafenib to natural products[J]. Eur J Med Chem, 2021, 224: 113690.
27	Fallahi P, Ferrari SM, Galdiero MR, et al. Molecular targets of tyrosine kinase inhibitors in thyroid cancer[J]. Semin Cancer Biol, 2022, 79: 180-96.
28	Li QH, Chen KX, Zhang TY, et al. Understanding sorafenib-induced ferroptosis and resistance mechanisms: implications for cancer therapy[J]. Eur J Pharmacol, 2023, 955: 175913.
29	Costa I, Barbosa DJ, Benfeito S, et al. Molecular mechanisms of ferroptosis and their involvement in brain diseases[J]. Pharmacol Ther, 2023, 244: 108373.
30	Sui XB, Zhang RN, Liu SP, et al. RSL3 drives ferroptosis through GPX4 inactivation and ROS production in colorectal cancer[J]. Front Pharmacol, 2018, 9: 1371.
31	Sun YD, Berleth N, Wu WX, et al. Fin56-induced ferroptosis is supported by autophagy-mediated GPX4 degradation and functions synergistically with mTOR inhibition to kill bladder cancer cells[J]. Cell Death Dis, 2021, 12(11): 1028.
32	Gaschler MM, Andia AA, Liu HR, et al. FINO2 initiates ferroptosis through GPX4 inactivation and iron oxidation[J]. Nat Chem Biol, 2018, 14(5): 507-15.
33	Cheung EC, Vousden KH. The role of ROS in tumour development and progression[J]. Nat Rev Cancer, 2022, 22(5): 280-97.

[1]	Mengdong ZHENG, Yan LIU, Jiaojiao LIU, Qiaozhen KANG, Ting WANG. Effect of deletion of protein 4.1R on proliferation, apoptosis and glycolysis of hepatocyte HL-7702 cells [J]. Journal of Southern Medical University, 2024, 44(7): 1355-1360.
[2]	Zhixian REN, Beixian ZHOU, Linxin WANG, Jing LI, Rongping ZHANG, Xiping PAN. Inhibitory effect of 5-hydroxy-6,7-dimethoxyflavone on H1N1 influenza virus-induced ferroptosis and inflammation in A549 cells and its possible mechanisms [J]. Journal of Southern Medical University, 2024, 44(6): 1070-1078.
[3]	Guiling CHEN, Xiaofeng LIAO, Pengtao SUN, Huan CEN, Shengchun SHU, Bijing LI, Jinhua LI. Solasonine promotes apoptosis of non-small cell lung cancer cells by regulating the Bcl-2/Bax/caspase-3 pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1109-1116.
[4]	Lingjun LU, Xiaodi YANG, Huaping ZHANG, Yuan LIANG, Xiulan SHI, Xin ZHOU. Recombinant Schistosoma japonicum cystatin alleviates acute liver injury in mice by inhibiting endoplasmic reticulum stress, inflammation and hepatocyte apoptosis [J]. Journal of Southern Medical University, 2024, 44(6): 1126-1134.
[5]	Fangyuan ZHANG, Gang LIU. Dexmedetomidine inhibits ferroptosis of human renal tubular epithelial cells by activating the Nrf2/HO-1/GPX4 pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1135-1140.
[6]	Ze YANG, Xiusen ZHANG, Xudong ZHANG, Ying LIU, Jiacheng ZHANG, Xiang YUAN. Porphyromonas gingivalis infection facilitates immune escape of esophageal cancer by enhancing YTHDF2-mediated Fas degradation [J]. Journal of Southern Medical University, 2024, 44(6): 1159-1165.
[7]	Guoxin LIANG, Hongyue TANG, Chang GUO, Mingming ZHANG. MiR-224-5p overexpression inhibits oxidative stress by regulating the PI3K/Akt/FoxO1 axis to attenuate hypoxia/reoxygenation-induced cardiomyocyte injury [J]. Journal of Southern Medical University, 2024, 44(6): 1173-1181.
[8]	Chang SUN, Shiyao ZHENG, Mei LI, Ming YANG, Mengyuan QIN, Yuan XU, Weihua LIANG, Jianmin HU, Lianghai WANG, Feng LI, Hong ZHOU, Lan YANG. High expression of the stemness-associated molecule Nanog in esophageal squamous cell carcinoma tissues promotes tumor invasion and metastasis by activating the TGF‑β signaling pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1209-1216.
[9]	Nan WANG, Bin SHI, Xiaolan MAN, Weichao WU, Jia CAO. High expression of fragile X mental retardation protein inhibits ferroptosis of colorectal tumor cells by activating the RAS/MAPK signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 885-893.
[10]	LI Shuxian, YU Shuping, MU Yaming, WANG Kai, LIU Yu, ZHANG Meihua. Metformin ameliorates PM2.5- induced functional impairment of placental trophoblasts by inhibiting ferroptosis [J]. Journal of Southern Medical University, 2024, 44(3): 437-446.
[11]	ZHANG Xiaoyan, WANG Xie, WANG Jie, SHAO Nan, CAI Biao, XIE Daojun. Huangpu Tongqiao Capsule improves cognitive impairment in rats with Wilson disease by inhibiting endoplasmic reticulum stress-mediated apoptosis pathway [J]. Journal of Southern Medical University, 2024, 44(3): 447-454.
[12]	CHEN Guodong, LUO Suxin. Colchicine alleviates myocardial ischemia-reperfusion injury in mice by activating AMPK [J]. Journal of Southern Medical University, 2024, 44(2): 226-235.
[13]	DUAN Ting, ZHANG Zhen, SHI Jinran, XIAO Linyu, YANG Jingjing, YIN Lixia, ZHANG Xiaofeng, GENG Zhijun, LU Guoyu. High expression of CPNE3 correlates with poor long-term prognosis of gastric cancer by inhibiting cell apoptosis via activating PI3K/AKT signaling [J]. Journal of Southern Medical University, 2024, 44(1): 129-137.
[14]	SUN Shuo, HUANG Xin, LI Guodong, ZHANG Chunyun, LU Zemei, ZHANG Weiwei, LI Zeyan, YANG Qingzhu. MACC1 knockdown enhances RSL3-induced ferroptosis in human colorectal cancer cells by inhibiting GPX4 expression [J]. Journal of Southern Medical University, 2024, 44(1): 173-178.
[15]	ZHANG Xiaohong, ZHAO Pin, KUAI Jianke, CHANG Chao, YUAN Qing. Spermidine alleviates lipopolysaccharide-induced myocardial injury in mice by suppressing apoptosis, ROS production and ferroptosis [J]. Journal of Southern Medical University, 2024, 44(1): 166-172.