Fecal microbiota transplantation inhibits colonic tumor growth in mice by suppressing the TLR4/MyD88/NF-κB signaling pathway

doi:10.12122/j.issn.1673-4254.2026.05.18

Abstract

Abstract:

Objective To explore the effects of fecal microbiota transplantation (FMT) on immune function and tumor inhibition in mice. Methods C57BL/6N mice were divided into blank control group, tumor bearing model group, and FMT intervention group (n=6). In the latter two groups, the mice bearing subcutaneous MC38 colon cancer cell xenografts were treated with daily gavage of normal saline or 0.1 mL of bacterial suspension. The changes in tumor mass and volume were recorded, and peripheral blood natural killer (NK) cell counts and NKG2A and NKG2D receptor expressions were analyzed using flow cytometry; serum lipopolysaccharide (LPS) levels were measured with ELISA. The binding ability of NF‑κB to the TGF‑β1 gene promoter was analyzed with JASPAR. The mRNA and protein expressions of TLR4, MyD88, NF‑κB, TGF‑β1, perforin and granzyme in the tumor tissues were detected using RT qPCR and Western blotting, and the changes in gut microbiota were analyzed using 16S high throughput sequencing. Results FMT significantly reduced tumor mass and volume in the tumor-bearing mice. Peripheral CD3⁻NK1.1⁺ cell counts were significantly decreased in the tumor-bearing mice regardless of FMT treatment, which, however, reversed the increase of CD3^-NKG2A⁺ cells and reduction of CD3^-NKG2D⁺ cells and reduced serum LPS levels in the mouse models. Molecular docking and JASPAR analysis confirmed LPS-TLR4 binding (binding energy: -13.1 kcal/mol) and identified NF-κB binding sites on TGF‑β1 promoter. FMT downregulated mRNA and protein expressions of TLR4, MyD88, NF‑κB and TGF‑β1 and upregulated perforin and granzyme mRNA expressions in the xenografts. FMT also restored gut microbiota diversity and composition, and reversed the increase of Proteobacteria and decrease of Lactobacillus murinus in the tumor-bearing mice. Conclusion FMT modulates the relative abundances of intestinal Proteobacteria and Lactobacillus murinus in tumor-bearing mice, and inhibits tumor growth by suppressing the TLR4/MyD88/NF‑κB signaling axis, down-regulating TGF-β1 expression, and promoting NK cell activation.

Key words: intestinal microbiota, TLR4/MyD88/NF-κB, transforming growth factor-β1, NKG2D/A, microbiota transplantation

Junqi ZHANG, Jing BAI, Xing REN, Xueshuai YE, Mengtian TAN, Yong YANG, Lei LI, Zexian FU. Fecal microbiota transplantation inhibits colonic tumor growth in mice by suppressing the TLR4/MyD88/NF-κB signaling pathway[J]. Journal of Southern Medical University, 2026, 46(5): 1139-1148.

Figures/Tables 9

Tab.1 Primer sequences for qRT-PCR

Gene Primer sequence (5' to 3')

TLR4 Forward primer TGAGGACTGGGTGAGAAATGAGC

Reverse primer CTGCCATGTTTGAGCAATCTCAT

MYD88 Forward primer TGACCCCACTCGCAGTTTGT

Reverse primer TTTGTTTGTGGGACACTGCTTTC

NF-κB p65 Forward primer CACCCCACCATCAAGATCAAT

Reverse primer GTCAGCCTCATAGTAGCCATCC

Granzyme Forward primer ATCCTCCTGCTACTGCTGACCTT

Reverse primer CTCCTGGCTTCACATTGACATTGC

Perforin Forward primer TCTCCTCCTATGGCACGCACTT

Reverse primer TCAGGCAGTCTCCTACCTCATCAG

GAPDH Forward primer CCTCGTCCCGTAGACAAAATG

Reverse primer TGAGGTCAATGAAGGGGTCGT

Fig.1 Comparison of general conditions and tumor growth in the mice in different groups (n=6). A: Growth curve of body mass in the 3 groups. B: Gross observation of the dissected tumors. C: Comparison of the tumor mass between the two tumor-bearing groups. D: Comparison of tumor volume between the two tumor-bearing groups. E: Comparison of spleen index among the 3 groups. **P<0.01 vs Control, ▲P<0.05 vs Model.

Fig.3 Comparison of the number of OTUs and α diversity analysis in the intestines of the mice among the 3 groups. A: Venn diagram at the start of the experiment. B: Venn diagram at the end of the experiment. C: Bar chart of gut OTUs in the 3 groups before and after the experiment. D: Chao1 index of the 3 groups before (pre) and at the end (post) of the experiment. E: Ace index of the 3 groups before and at the end of the experiment. F: Shannon index of the 3 groups before and at the end of the experiment. *P<0.05, **P<0.01 vs pre-experiment in the same group.

Fig.4 Comparison of intestinal beta diversity among the 3 groups. A: NMDS analysis at the beginning of the experiment. B: NMDS analysis at the end of the experiment.

Fig.5 Comparison of intestinal flora levels among the 3 groups. A: Analysis of species composition at the phylum level. B: Analysis of species composition at the species level. C: Column chart for comparison of Proteobacteria. D: Column chart of Lactobacillus murinus in the 3 groups. **P<0.01, ***P<0.001 vs Control; ▲P<0.05 vs Model.

Fig.6 Molecular docking results (A) and LPS levels (B) in mouse peripheral blood (n=5). **P<0.01 vs Control; ▲P<0.05 vs Model.

Fig.7 Effect of FMT on mRNA expression in mouse tumor and intestinal tissues (n=5). A: Effect of FMT on mRNA expressions of TLR4, MYD88, NF-κB p65, perforin and granzyme in the tumor tissues. B: Effects of FMT on mRNA expressions of TLR4, MYD88 and NF-κB p65 in the colon tissue. C: NF-κB binds to the TGF-β1 promoter site. **P<0.01, ***P<0.001 vs Control; ▲P<0.05, ▲▲P<0.01 vs Model.

Fig.8 Effect of FMT on protein expression in tumor and intestinal tissues of the mice (n=5).A: Effects of FMT on protein expressions of TLR4, MYD88, NF-κB p65 and TGF-β1 in mouse tumor tissues. B: Effects of FMT o protein expressions of TLR4, MYD88 and NF-κB p65 in the colon tissue of the mice. *P<0.05 vs Control; ▲P<0.05, ▲▲P<0.01 vs Model.

References 31

[1]	Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries[J]. CA Cancer J Clin, 2024, 74(3): 229-63. doi：10.3322/caac.21834
[2]	Singh M, Morris VK, Bandey IN, et al. Advancements in combining targeted therapy and immunotherapy for colorectal cancer[J]. Trends Cancer, 2024, 10(7): 598-609. doi：10.1016/j.trecan.2024.05.001
[3]	Ghosh SS, Wang J, Yannie PJ, et al. Intestinal barrier dysfunction, LPS translocation, and disease development[J]. J Endocr Soc, 2020, 4(2): bvz039. doi：10.1210/jendso/bvz039
[4]	Li R, Zhou R, Wang H, et al. Gut microbiota-stimulated cathepsin K secretion mediates TLR4-dependent M2 macrophage polarization and promotes tumor metastasis in colorectal cancer[J]. Cell Death Differ, 2019, 26(11): 2447-63. doi：10.1038/s41418-019-0312-y
[5]	Mansouri A, Akthar I, Miyamoto A. TLR2 and TLR4 bridge physiological and pathological inflammation in the reproductive system[J]. Commun Biol, 2025, 8(1): 1008. doi：10.1038/s42003-025-08424-x
[6]	Wu ZB, Guo JX, Zhang ZH, et al. Bacteroidetes promotes esophageal squamous carcinoma invasion and metastasis through LPS-mediated TLR4/Myd88/NF-κB pathway and inflammatory changes[J]. Sci Rep, 2024, 14: 12827. doi：10.1038/s41598-024-63774-6
[7]	Li C, Li HX, Jiang K, et al. TLR4 signaling pathway in mouse Lewis lung cancer cells promotes the expression of TGF-β1 and IL-10 and tumor cells migration[J]. Bio Med Mater Eng, 2014, 24(1): 869-75. doi：10.3233/bme-130879
[8]	Švubová V, Janstová L, Jedlička M, et al. TGF-β decreases NK cell mobility and cytotoxic efficacy in complex in vitro models of the leukemia microenvironment[J]. ImmunoTargets Ther, 2025, 14: 589-604. doi：10.2147/itt.s512700
[9]	Ma MZ, Shi FX, Zhai RN, et al. TGF-β promote epithelial-mesenchymal transition via NF‑κB/NOX4/ROS signal pathway in lung cancer cells[J]. Mol Biol Rep, 2021, 48(3): 2365-75. doi：10.1007/s11033-021-06268-2
[10]	Kuznetsova AV, Glukhova XA, Beletsky IP, et al. NK cell activity in the tumor microenvironment[J]. Front Cell Dev Biol, 2025, 13: 1609479. doi：10.3389/fcell.2025.1609479
[11]	Baunwall SMD, Andreasen SE, Hansen MM, et al. Faecal microbiota transplantation for first or second Clostridioides difficile infection (EarlyFMT): a randomised, double-blind, placebo-controlled trial[J]. Lancet Gastroenterol Hepatol, 2022, 7(12): 1083-91. doi：10.1016/s2468-1253(22)00276-x
[12]	Zhang J, Wu KH, Shi CC, et al. Cancer immunotherapy: fecal microbiota transplantation brings light[J]. Curr Treat Options Oncol, 2022, 23(12): 1777-92. doi：10.1007/s11864-022-01027-2
[13]	Zhao Z, Ning JW, Bao XQ, et al. Fecal microbiota transplantation protects rotenone-induced Parkinson's disease mice via suppressing inflammation mediated by the lipopolysaccharide-TLR4 signaling pathway through the microbiota-gut-brain axis[J]. Microbiome, 2021, 9(1): 226. doi：10.1186/s40168-021-01107-9
[14]	Bokoliya SC, Dorsett Y, Panier H, et al. Procedures for fecal microbiota transplantation in murine microbiome studies[J]. Front Cell Infect Microbiol, 2021, 11: 711055. doi：10.3389/fcimb.2021.711055
[15]	Lu YT, Yuan XL, Wang M, et al. Gut microbiota influence immunotherapy responses: mechanisms and therapeutic strategies[J]. J Hematol Oncol, 2022, 15(1): 47. doi：10.1186/s13045-022-01273-9
[16]	Van Dingenen L, Segers C, Wouters S, et al. Dissecting the role of the gut microbiome and fecal microbiota transplantation in radio- and immunotherapy treatment of colorectal cancer[J]. Front Cell Infect Microbiol, 2023, 13: 1298264. doi：10.3389/fcimb.2023.1298264
[17]	Hooper LV, Littman DR, MacPherson AJ. Interactions between the microbiota and the immune system[J]. Science, 2012, 336(6086): 1268-73. doi：10.1126/science.1223490
[18]	Zhang SY, Wen HM, Chen Y, et al. Crosstalk between gut microbiota and tumor: tumors could cause gut dysbiosis and metabolic imbalance[J]. Mol Oncol, 2025, 19(6): 1707-24. doi：10.1002/1878-0261.13763
[19]	Hays KE, Pfaffinger JM, Ryznar R. The interplay between gut microbiota, short-chain fatty acids, and implications for host health and disease[J]. Gut Microbes, 2024, 16(1): 2393270. doi：10.1080/19490976.2024.2393270
[20]	Han X, Zhang BW, Zeng W, et al. Suppressed oncogenic molecules involved in the treatment of colorectal cancer by fecal microbiota transplantation[J]. Front Microbiol, 2024, 15: 1451303. doi：10.3389/fmicb.2024.1451303
[21]	Dheer R, Santaolalla R, Davies JM, et al. Intestinal epithelial toll-like receptor 4 signaling affects epithelial function and colonic microbiota and promotes a risk for transmissible colitis[J]. Infect Immun, 2016, 84(3): 798-810. doi：10.1128/iai.01374-15
[22]	Li Q, von Ehrlich-Treuenstätt V, Schardey J, et al. Gut barrier dysfunction and bacterial lipopolysaccharides in colorectal cancer[J]. J Gastrointest Surg, 2023, 27(7): 1466-72. doi：10.1007/s11605-023-05654-4
[23]	He JK, Li HJ, Jia JQ, et al. Mechanisms by which the intestinal microbiota affects gastrointestinal tumours and therapeutic effects[J]. Mol Biomed, 2023, 4(1): 45. doi：10.1186/s43556-023-00157-9
[24]	Peng C, Ouyang YB, Lu NH, et al. The NF-κB signaling pathway, the microbiota, and gastrointestinal tumorigenesis: recent advances[J]. Front Immunol, 2020, 11: 1387. doi：10.3389/fimmu.2020.01387
[25]	Zhao S, Zhang YF, Zhang QY, et al. Toll-like receptors and prostate cancer[J]. Front Immunol, 2014, 5: 352. doi：10.3389/fimmu.2014.00352
[26]	Batlle E, Massagué J. Transforming growth factor‑β signaling in immunity and cancer[J]. Immunity, 2019, 50(4): 924-40. doi：10.1016/j.immuni.2019.03.024
[27]	Lazarova M, Steinle A. Impairment of NKG2D-mediated tumor immunity by TGF-β[J]. Front Immunol, 2019, 10: 2689. doi：10.3389/fimmu.2019.02689
[28]	André P, Denis C, Soulas C, et al. Anti-NKG2A MAb is a checkpoint inhibitor that promotes anti-tumor immunity by unleashing both T and NK cells[J]. Cell, 2018, 175(7): 1731-43.e13. doi：10.1016/j.cell.2018.10.014
[29]	Valeri A, García-Ortiz A, Castellano E, et al. Overcoming tumor resistance mechanisms in CAR-NK cell therapy[J]. Front Immunol, 2022, 13: 953849. doi：10.3389/fimmu.2022.953849
[30]	Krijgsman D, de Vries NL, Skovbo A, et al. Characterization of circulating T-, NK-, and NKT cell subsets in patients with colorectal cancer: the peripheral blood immune cell profile[J]. Cancer Immunol Immunother, 2019, 68(6): 1011-24. doi：10.1007/s00262-019-02343-7
[31]	Prager I, Liesche C, van Ooijen H, et al. NK cells switch from granzyme B to death receptor-mediated cytotoxicity during serial killing[J]. J Exp Med, 2019, 216(9): 2113-27. doi：10.1084/jem.20181454