The splicing factor HNRNPH1 regulates Circ-MYOCD back-splicing to modulate the course of cardiac hypertrophy

doi:10.12122/j.issn.1673-4254.2025.03.16

Abstract

Abstract:

Objective To explore the mechanism of Circ-MYOCD back-splicing and its regulatory role in myocardial hypertrophy. Methods Sanger sequencing and RNase R assays were performed to verify the circularity and stability of Circ-MYOCD, whose subcellular distribution was determined by nuclear-cytoplasmic fractionation. Bioinformatics analysis and mass spectrometry from pull-down assays were conducted to predict the RNA-binding proteins (RBPs) interacting with Circ-MYOCD. In rat cardiomyocytes H9C2 cells, the effects of HNRNPH1 and HNRNPL knockdown and overexpression on Circ-MYOCD back-splicing were evaluated. In a H9C2 cell model of angiotensin II (Ang II)-induced myocardial hypertrophy, the expression of HNRNPH1 was detected, the effects of HNRNPH1 knockdown and overexpression on progression of myocardial hypertrophy were assessed, and the regulatory effect of HNRNPH1 on Circ-MYOCD back-splicing was analyzed. Results Sanger sequencing confirmed that the junction primers could amplify the correct Circ-MYOCD sequence. RNase R and nuclear-cytoplasmic fractionation assays showed that Circ-MYOCD was stable and predominantly localized in the cytoplasm. Bioinformatics analysis and mass spectrometry from the Circ-MYOCD pull-down assay identified HNRNPH1 and HNRNPL as the RBPs interacting with Circ-MYOCD. In H9C2 cells, HNRNPH1 knockdown significantly enhanced while its overexpression inhibited Circ-MYOCD back-splicing; HNRNPH1 overexpression obviously increased the expressions of myocardial hypertrophy markers ANP and BNP, while its knockdown produced the opposite effect. In Ang II-induced H9C2 cells, which exhibited a significant increase of HNRNPH1 expression and increased expressions of ANP and BNP, HNRNPH1 knockdown obviously increased Circ-MYOCD expression, decreased MYOCD expression and lowered both ANP and BNP expressions. Conclusion HNRNPH1 regulates Circ-MYOCD back-splicing to influence the progression of myocardial hypertrophy.

Key words: cardiac hypertrophy, back-splicing, circular RNA, splicing factors, HNRNPH1

Rui CAI, Zhuo HUANG, Wenxia HE, Tianhong AI, Xiaowei SONG, Shuting HU. The splicing factor HNRNPH1 regulates Circ-MYOCD back-splicing to modulate the course of cardiac hypertrophy[J]. Journal of Southern Medical University, 2025, 45(3): 587-594.

Figures/Tables 7

Tab.1 Primer sequences for qRT-PCR

Forward:

Reverse:

AACGACCCCTTCATTGACCTC

CCTTGACTGTGCCGTTGAACT

Rno-ANP

Forward:

Reverse:

GCCCTGAGCGAGCAGACCGA

CGGAAGCTGTTGCAGCCTA

Rno-BNP

Forward:

Reverse:

AGTCCTAGCAGTCTCAGA

GTCTCTCCGGATCCGGAAG

Rno-HnRNPH1

Forward:

Reverse:

GTGCAGTTTGCTTCACAGGA

CCATCCCCATATCTGTGGTC

Rno-HnRNPL

Forward:

Reverse:

AAGAGGCAGGCACTGGTAGA

GGCACTTTGCACAGAATCAA

Forward :

Reverse:

GCTCGCTTCGGCAGCACA

AACGCTTCACGAATTTGCGT

Rno-Circ-MYOCD

Forward:

Reverse:

CTTGCAGATGACCTCAACGA

TGGACTTTTCAGGGGTGGTA

Rno-MYOCD

Forward:

Reverse:

CATTGGGAAGGTGAGCGATG

TGTATGCATAGGGGAGAGCG

Fig.1 Identification of the circularity, localization, and stability of Circ-MYOCD in H9C2 Cells. A: Circ-MYOCD is composed of exons 2 to 5 of the MYOCD gene. B: Agarose gel electrophoresis of PCR amplification products of Circ-MYOCD. C: Sanger sequencing results of Circ-MYOCD. D: Stability validation of Circ-MYOCD (n=3). E: Localization of Circ-MYOCD within cells (n=3). ***P<0.001 vs control.

Fig.2 Predicted RNA-binding proteins (RBPs) associated with Circ-MYOCD.

Fig.3 Effects of HNRNPH1 and HNRNPL knockdown on Circ-MYOCD and MYOCD expression in H9C2 cells. A: Knockdown efficiency of si-HNRNPH1 in H9C2 cells. B: Knockdown efficiency of si-HNRNPL in H9C2 cells. C: Expression levels of Circ-MYOCD and MYOCD in H9C2 cells after transfection with si-HNRNPH1. D: Expression levels of Circ-MYOCD and MYOCD after transfection with si-HNRNPL in H9C2 cells. n=3; *P<0.01, **P<0.05, ***P<0.001 vs NC.

Fig.4 HNRNPH1 potentially regulates Circ-MYOCD back-splicing. A: Fluorescence images of H9C2 cells infected with Ad-HNRNPH1 recombinant adenovirus. B: Verification of overexpression efficiency of Ad-HNRNPH1 recombinant adenovirus (n=3). C: Expression levels of Circ-MYOCD and MYOCD after overexpression of HNRNPH1 (n=3). *P<0.01, **P<0.05, ***P<0.001 vs GFP.

Fig.5 HNRNPH1 potentially promotes the development of cardiac hypertrophy. A: Construction of cardiac hypertrophy model in H9C2 cells by treatment with Ang II. B: Expression of HNRNPH1 in the hypertrophic cell model. C: Changes in ANP and BNP expressions after HNRNPH1 knockdown. D: Changes in ANP and BNP expressions after HNRNPH1 overexpression. n=3, **P<0.05, ***P<0.001 vs ANP or Control.

Fig.6 HNRNPH1 influences Circ-MYOCD back-splicing and regulates the progression of cardiac hypertrophy. A: Knockdown efficiency of HNRNPH1 in the rat cardiac hypertrophy cell model. B: Changes in Circ-MYOCD and MYOCD expression after HNRNPH1 knockdown in the cardiac hypertrophy cell model. C: Changes in ANP and BNP expression after HNRNPH1 knockdown in the cardiac hypertrophy model. n=3, *P<0.01, **P<0.05, ***P<0.001.

References 30

1	Bazgir F, Nau J, Nakhaei-Rad S, et al. The microenvironment of the pathogenesis of cardiac hypertrophy[J]. Cells, 2023, 12(13): 1780.
2	Bai YY, Zhang XY, Li Y, et al. Protein kinase A is a master regulator of physiological and pathological cardiac hypertrophy[J]. Circ Res, 2024, 134(4): 393-410.
3	Shimizu I, Minamino T. Physiological and pathological cardiac hypertrophy[J]. J Mol Cell Cardiol, 2016, 97: 245-62.
4	Zhu Feng. An essential introduction to the 2023 guideline for diagnosis and treatment patients with hypertrophic cardiomyopathy[J]. J Clin Cardiol, 2023, 39(6): 413-6.
5	Hwang HJ, Kim YK. Molecular mechanisms of circular RNA translation[J]. Exp Mol Med, 2024, 56(6): 1272-80.
6	Chen LL. The expanding regulatory mechanisms and cellular functions of circular RNAs[J]. Nat Rev Mol Cell Biol, 2020, 21(8): 475-90.
7	Verduci L, Tarcitano E, Strano S, et al. CircRNAs: role in human diseases and potential use as biomarkers[J]. Cell Death Dis, 2021, 12(5): 468.
8	Wang MM, Wang BZ, Adi D, et al. Analysis on tissue-related biomarkers in patients with acute aortic dissection[J]. Zhonghua Xin Xue Guan Bing Za Zhi, 2021, 49(11): 1108-16.
9	Wang LJ, Feng JY, Feng X, et al. Exercise-induced circular RNA circUtrn is required for cardiac physiological hypertrophy and prevents myocardial ischaemia-reperfusion injury[J]. Cardiovasc Res, 2023, 119(16): 2638-52.
10	Zhao HL, Tan ZQ, Zhou J, et al. The regulation of circRNA and lncRNAprotein binding in cardiovascular diseases: Emerging therapeutic targets[J]. Biomed Pharmacother, 2023, 165: 115067.
11	杨静. Circ-MYOCD参与心肌肥厚的功能与机制研究[D]. 银川: 宁夏医科大学, 2022.
12	Wang JM, Sun D, Wang MS, et al. Multiple functions of heterogeneous nuclear ribonucleoproteins in the positive single-stranded RNA virus life cycle[J]. Front Immunol, 2022, 13: 989298.
13	Kinoshita C, Kubota N, Aoyama K. Interplay of RNA-binding proteins and microRNAs in neurodegenerative diseases[J]. Int J Mol Sci, 2021, 22(10): 5292.
14	Du JX, Zhu GQ, Cai JL, et al. Splicing factors: Insights into their regulatory network in alternative splicing in cancer[J]. Cancer Lett, 2021, 501: 83-104.
15	Gupta K, Yang CX, McCue K, et al. Improved modeling of RNA-binding protein motifs in an interpretable neural model of RNA splicing[J]. Genome Biol, 2024, 25(1): 23.
16	Chen YH, Zhong LF, Hong X, et al. Integrated analysis of circRNA-miRNA-mRNA CeRNA network in cardiac hypertrophy[J]. Front Genet, 2022, 13: 781676.
17	Xiao J, Joseph S, Xia MW, et al. Circular RNAs acting as miRNAs' sponges and their roles in stem cells[J]. J Clin Med, 2022, 11(10): 2909.
18	Jia KN, Cheng HM, Ma WQ, et al. RNA helicase DDX5 maintains cardiac function by regulating CamkIIδ alternative splicing[J]. Circulation, 2024, 150(14): 1121-39.
19	Shi QH, Wang JY, Yang Z, et al. CircAGFG1modulates autophagy and apoptosis of macrophages infected by Mycobacterium tuberculosis via the Notch signaling pathway[J]. Ann Transl Med, 2020, 8(10): 645.
20	Wei JX, Li MN, Xue CN, et al. Understanding the roles and regulation patterns of circRNA on its host gene in tumorigenesis and tumor progression[J]. J Exp Clin Cancer Res, 2023, 42(1): 86.
21	Liu CX, Chen LL. Circular RNAs: Characterization, cellular roles, and applications[J]. Cell, 2022, 185(12): 2016-34.
22	Saha K, Fernandez MM, Biswas T, et al. Discovery of a pre-mRNA structural scaffold as a contributor to the mammalian splicing code[J]. Nucleic Acids Res, 2021, 49(12): 7103-21.
23	Zhang XF, Zhan XC, Bian T, et al. Structural insights into branch site proofreading by human spliceosome[J]. Nat Struct Mol Biol, 2024, 31(5): 835-45.
24	Li DY, Yu WY, Lai MD. Towards understandings of serine/arginine-rich splicing factors[J]. Acta Pharm Sin B, 2023, 13(8): 3181-207.
25	Tao YN, Zhang Q, Wang HY, et al. Alternative splicing and related RNA binding proteins in human health and disease[J]. Signal Transduct Target Ther, 2024, 9: 26.
26	李伟锋. CircHNRNPH1在心肌梗死后心肌纤维化中作用机制的研究[D]. 上海: 上海交通大学, 2019.
27	Wu WB, Chen A, Lin SM, et al. The identification and verification of hub genes associated with pulmonary arterial hypertension using weighted gene co-expression network analysis[J]. BMC Pulm Med, 2022, 22(1): 474.
28	Yuan Q, Sun YW, Yang F, et al. CircRNA DICAR as a novel endogenous regulator for diabetic cardiomyopathy and diabetic pyroptosis of cardiomyocytes[J]. Signal Transduct Target Ther, 2023, 8(1): 99.
29	Li WF, Wang Y, Deng YF, et al. Epigenetic control of circHNRNPH1 in postischemic myocardial fibrosis through targeting of TGF‑β receptor type I[J]. Mol Ther Nucleic Acids, 2020, 25: 93-104.
30	Brownmiller T, Caplen NJ. The HNRNPF/H RNA binding proteins and disease[J]. Wiley Interdiscip Rev RNA, 2023, 14(5): e1788.

[1]	YE Hongwei, ZHANG Yuming, YUN Qi, DU Ruoli, LI Lu, LI Yuping, GAO Qin. Resveratrol alleviates hyperglycemia-induced cardiomyocyte hypertrophy by maintaining mitochondrial homeostasis via enhancing SIRT1 expression [J]. Journal of Southern Medical University, 2024, 44(1): 45-51.
[2]	ZHANG Ling, ZHAO Chunyu, XU Yaoyao, CHEN Yansen, CAI Zhixiong, LIN Haowei, CAI Qiaoyan. Circular RNA hsa_circ_0006834 is a potential prognostic biomarker for hepatocellular carcinoma [J]. Journal of Southern Medical University, 2023, 43(11): 1850-1856.
[3]	ZHOU Peitao, CHENG Binglin, SUN Yining, WU Dehua, CHEN Yuhan. Circular RNA circRSF1 binds to HuR to promote radiation-induced inflammatory phenotype in hepatic stellate cells [J]. Journal of Southern Medical University, 2023, 43(1): 46-51.
[4]	ZUO Xueliang, CAI Juan, CHEN Zhiqiang, LI Yanna, ZHANG Doufeng. CircPCSK5 is highly expressed in gastric cancer and promotes cancer cell proliferation, invasion and epithelial-mesenchymal transition [J]. Journal of Southern Medical University, 2022, 42(10): 1440-1451.
[5]	. CircRNA_005647 inhibits expressions of fibrosis-related genes in mouse cardiac fibroblasts via sponging miR-27b-3p [J]. Journal of Southern Medical University, 2019, 39(11): 1312-1319.
[6]	. Role of miRNA-340 in modulating gastric cancer cell proliferation and bioinformatic analysis [J]. Journal of Southern Medical University, 2019, 39(07): 784-.
[7]	TAN Jian-xin¹, LIU Chen-zhou¹, JIE Yu-li², WANG You¹, HUANG Yu-ge¹. Effect of cyclosporine A on myocardial calcineurin activity of the right ventricle and plasma NO,nitric oxide synthase and endothelin-1levels in rats with chronic hypoxia [J]. Journal of Southern Medical University, 2004, 24(06): 656-658.