Swertiamarin ameliorates 2,4,6-trinitrobenzenesulfonic acid-induced colitis in mice by inhibiting intestinal epithelial cell apoptosis

doi:10.12122/j.issn.1673-4254.2024.08.13

Abstract

Abstract:

Objective To investigate the mechanism by which swertiamarin (STM) ameliorates CD-like colitis in mice. Methods A Caco-2 cell model of TNF‑α‑stimulated apoptosis was established and divided into three groups: Con, TNF-α and STM, and the effects of STM on apoptosis and barrier function were assessed by Tunel staining, western blotting, immunofluorescence, and transepithelial electric resistance (TEER). A mouse model of 2,4,6-trinitrobenzenesulfonic acid (TNBS)-induced CD-like colitis was established to assess the effects of STM on colitis, intestinal barrier function and epithelial cell apoptosis. The regulatory role of the PI3K/AKT pathway in STM-induced resistance to intestinal epithelial cell apoptosis was investigated in both the cell model and mouse models. Results TUNEL staining showed that in Caco-2 cells with TNF‑α stimulation, STM treatment significantly reduced the percentage of TUNEL-stained cells (P<0.05). STM obviously reduced TNF‑α‑induced enhancement of cleaved-caspase 3 and Bax expressions (P<0.05), increased Bcl-2 expression (P<0.05), protected intestinal barrier integrity and function by restoring transepithelial electrical resistance (TEER) of the cells, promoted normal localization and expressions of the tight junction proteins (ZO1 and claudin 1) (P<0.05), and inhibited the expression of pro-inflammatory factors (IL-6 and CCL3) (P<0.05) in TNF‑α-stimulated Caco-2 cells. In the mouse models, STM significantly alleviated TNBS-induced CD-like colitis and intestinal barrier dysfunction (P<0.05) as shown by improved weight loss, lowered Disease Activity Index (DAI) score and inflammation score, reduction of IL-6 and CCL3 release, and restoration of intestinal barrier permeability, colonic TEER, bacterial translocation, and localization and expressions of the tight junction proteins. Mechanistically, STM inhibited the expressions of p-PI3K and p-AKT in both the cell model and mouse model(P<0.05), and treatment with 740Y-P (a PI3K/AKT pathway activator) significantly attenuated the inhibitory effect of STM on TNF‑α‑induced apoptosis in Caco-2 cells (P<0.05). Conclusion STM inhibits intestinal epithelial cell apoptosis at least in part by suppressing activation of the PI3K/AKT pathway to ameliorate intestinal barrier dysfunction and colitis in mice.

Key words: Crohn's disease, intestinal barrier, intestinal epithelial cell apoptosis, swertiamarin, PI3K/AKT pathway

Shuo LIU, Jing LI, Xingwang WU. Swertiamarin ameliorates 2,4,6-trinitrobenzenesulfonic acid-induced colitis in mice by inhibiting intestinal epithelial cell apoptosis[J]. Journal of Southern Medical University, 2024, 44(8): 1545-1552.

Figures/Tables 8

Tab.1 Primers Sequence

Primers	Forward (5'-3')	Reverse (5'-3')
IL-6	TCTATACCACTTCACAAGTCGGA	GAATTGCCATTGCACAACTCTTT
CCL3	CTCCCAGCCAGGTGTCATTTT	CTTGGACCCAGGTCTCTTTGG
GAPDH	TGGCCTTCCGTGTTCCTAC	GAGTTGCTGTTGAAGTCGCA

Fig.1 Effect of STM on TNF-α-induced apoptosis in Caco-2 cells. A, B: Representative images of TUNEL staining and statistical analysis of the positively stained cells. C-F: Levels of c-caspase 3, Bax and Bcl2 detected by Western blotting. *P<0.05 vs Control group/WT group. #P<0.05 vs TNF-α group.

Fig.2 Effect of STM on TNF-α-induced barrier dysfunction and inflammatory responses in Caco-2 cells. A: Detection of TEER values. B: Immunofluorescence staining of ZO1 and claudin 1. C-E: Levels of ZO1 and claudin 1 detected by Western blotting. F, G: qRT-PCR for detecting expressions of IL-6 and CCL3. H, I: Levels of IL-6 and CCL3 detected by ELISA. *P<0.05 vs Control group, WT group. #P<0.05 vs TNF-α group.

Fig.3 Effect of STM on TNBS-induced CD-like colitis in mice. A: Body weight changes of the mice. B: DAI score. C, D: HE staining and inflammation score of the colonic tissue. E, F: qRT-PCR for detecting mRNA expressions of IL-6 and CCL3. G, H: Levels of IL-6 and CCL3 detected by ELISA. *P<0.05 vs WT group. #P<0.05 vs TNBS group.

Fig.4 Effect of STM on intestinal barrier in TNBS-induced mice. A: Intestinal barrier permeability assay. B: TEER analysis of the colonic tissues. C-E: Assessment of the percentage of bacterial translocation in the intestinal lymph nodes, spleen and liver. F: Immunofluorescence staining of ZO1 and claudin 1. G-I: Levels of ZO1 and claudin 1 detected by Western blotting. *P<0.05 vs WT group. #P<0.05 vs TNBS group.

Fig. 5 Effect of STM on apoptosis of intestinal epithelial cells in TNBS-induced mice. A, B: Representative image of TUNEL staining and statistical analysis of the positively stained intestinal epithelial cells. C-F: Levels of c-caspase 3, Bax and Bcl2 detected by Western blotting. *P<0.05 vs WT group. #P<0.05 vs TNBS group.

Fig. 6 In vitro and in vivo experiments for validating the effect of STM on the PI3K/AKT pathway. A-C: Levels of p-PI3K, PI3K, p-AKT and AKT detected in TNF-α-induced Caco-2 cells by Western blotting. D-F: Western blotting for detecting expression levels of p-PI3K, PI3K, p-AKT and AKT in the intestinal mucosal tissues of TNBS-induced mice. *P<0.05 vs WT or Con group. #P<0.05 vs TNBS or TNF-α group.

Fig.7 The PI3K/AKT pathway is involved in STM-mediated inhibition of intestinal epithelial cell apoptosis. A, B: TUNEL staining and statistical analysis of the positively stained intestinal epithelial cells. C-F: Levels of c-caspase 3, Bax and Bcl2 detected by Western blotting. *P<0.05 vs STM group.

References 37

1	Roda G, Chien Ng S, Kotze PG, et al. Crohn’s disease[J]. Nat Rev Dis Primers, 2020, 6(1): 22.
2	Ananthakrishnan AN, Bernstein CN, Iliopoulos D, et al. Environmental triggers in IBD: a review of progress and evidence[J]. Nat Rev Gastroenterol Hepatol, 2018, 15(1): 39-49.
3	Lo BC, Shin SB, Canals Hernaez D, et al. IL-22 preserves gut epithelial integrity and promotes disease remission during chronic Salmonella infection[J]. J Immunol, 2019, 202(3): 956-65.
4	Deng FH, Peng L, Li ZJ, et al. YAP triggers the Wnt/β-catenin signalling pathway and promotes enterocyte self-renewal, regeneration and tumorigenesis after DSS-induced injury[J]. Cell Death Dis, 2018, 9(2): 153.
5	Stremmel W, Staffer S, Schneider MJ, et al. Genetic mouse models with intestinal-specific tight junction deletion resemble an ulcerative colitis phenotype[J]. J Crohns Colitis, 2017, 11(10): 1247-57.
6	Woznicki JA, Saini, Flood P, et al. TNF-α synergises with IFN-γ to induce caspase-8-JAK1/2-STAT1-dependent death of intestinal epithelial cells[J]. Cell Death Dis, 2021, 12(10): 864.
7	Dotti I, Mora-Buch R, Ferrer-Picón E, et al. Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis[J]. Gut, 2017, 66(12): 2069-79.
8	Zhang J, Cen L, Zhang XF, et al. MPST deficiency promotes intestinal epithelial cell apoptosis and aggravates inflammatory bowel disease via AKT[J]. Redox Biol, 2022, 56: 102469.
9	Lei H, Yang L, Xu HZ, et al. Ubiquitin-specific protease 47 regulates intestinal inflammation through deubiquitination of TRAF6 in epithelial cells[J]. Sci China Life Sci, 2022, 65(8): 1624-35.
10	Zhao S, Dejanovic D, Yao P, et al. Selective deletion of MyD88 signaling in α‑SMA positive cells ameliorates experimental intestinal fibrosis via post-transcriptional regulation[J]. Mucosal Immunol, 2020, 13(4): 665-78.
11	Mao R, Doyon G, Gordon IO, et al. Activated intestinal muscle cells promote preadipocyte migration: a novel mechanism for creeping fat formation in Crohn's disease[J]. Gut, 2022, 71(1): 55-67.
12	Zhang QR, Chen K, Wu T, et al. Swertiamarin ameliorates carbon tetrachloride-induced hepatic apoptosis via blocking the PI3K/Akt pathway in rats[J]. Korean J Physiol Pharmacol, 2019, 23(1): 21-8.
13	Saravanan S, Islam VI, Thirugnanasambantham K, et al. Swertiamarin ameliorates inflammation and osteoclastogenesis intermediates in IL-1β induced rat fibroblast-like synoviocytes[J]. Inflamm Res, 2014, 63(6): 451-62.
14	Yang WJ, Han FH, Gu YP, et al. TGR5 agonist inhibits intestinal epithelial cell apoptosis via cAMP/PKA/c-FLIP/JNK signaling pathway and ameliorates dextran sulfate sodium-induced ulcerative colitis[J]. Acta Pharmacol Sin, 2023, 44(8): 1649-64.
15	Li R, Shi CR, Wei CT, et al. Fufang Shenhua Tablet inhibits renal fibrosis by inhibiting PI3K/AKT[J]. Phytomedicine, 2023, 116: 154873.
16	Zuo LG, Geng ZJ, Song X, et al. Browning of mesenteric white adipose tissue in Crohn's disease: a new pathological change and therapeutic target[J]. J Crohns Colitis, 2023, 17(8): 1179-92.
17	Huang LY, Qian WW, Xu YH, et al. Mesenteric adipose tissue contributes to intestinal fibrosis in Crohn's disease through the ATX-LPA axis[J]. J Crohns Colitis, 2022, 16(7): 1124-39.
18	Shi YJ, Sheng WJ, Xue MT, et al. Effect of morroniside on the transcriptome profiles of rat in injured spinal cords[J]. Gene, 2022, 823: 146338.
19	Kucharzik T, Ellul P, Greuter T, et al. ECCO guidelines on the prevention, diagnosis, and management of infections in inflammatory bowel disease[J]. J Crohns Colitis, 2021, 15(6): 879-913.
20	Wang T, Wu SB, Ibrahim IAA, et al. Cardioprotective role of swertiamarin, a plant glycoside against experimentally induced myocardial infarction via antioxidant and anti-inflammatory functions[J]. Appl Biochem Biotechnol, 2023, 195(9): 5394-408.
21	Wang GW, Quan J, Su NR, et al. Proteomic analysis of swertiamarin-treated BV-2 cells and possible implications in neuroinflammation[J]. J Oleo Sci, 2022, 71(3): 395-400.
22	Patel N, Zinzuvadia A, Prajapati M, et al. Swertiamarin-mediated immune modulation/adaptation confers protection against Plasmodium berghei [J]. Future Microbiol, 2022, 17: 931-41.
23	Okayasu I, Hatakeyama S, Yamada M, et al. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice[J]. Gastroenterology, 1990, 98(3): 694-702.
24	Gäbele E, Dostert K, Hofmann C, et al. DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH[J]. J Hepatol, 2011, 55(6): 1391-9.
25	Dong LJ, Xie JW, Wang YY, et al. Mannose ameliorates experimental colitis by protecting intestinal barrier integrity[J]. Nat Commun, 2022, 13(1): 4804.
26	Kinchen J, Chen HH, Parikh K, et al. Structural remodeling of the human colonic mesenchyme in inflammatory bowel disease[J]. Cell, 2018, 175(2): 372-86.e17.
27	Varani J, McClintock SD, Aslam MN. Cell-matrix interactions contribute to barrier function in human colon organoids[J]. Front Med, 2022, 9: 838975.
28	Jelinsky SA, Derksen M, Bauman E, et al. Molecular and functional characterization of human intestinal organoids and monolayers for modeling epithelial barrier[J]. Inflamm Bowel Dis, 2023, 29(2): 195-206.
29	Chen SB, Liu HB, Li ZJ, et al. Epithelial PBLD attenuates intestinal inflammatory response and improves intestinal barrier function by inhibiting NF-κB signaling[J]. Cell Death Dis, 2021, 12(6): 563.
30	Kuo WT, Shen L, Zuo L, et al. Inflammation-induced occludin downregulation limits epithelial apoptosis by suppressing caspase-3 expression[J]. Gastroenterology, 2019, 157(5): 1323-37.
31	Li CC, Gong LQ, Jiang Y, et al. Sanguisorba officinalis ethyl acetate extract attenuates ulcerative colitis through inhibiting PI3K-AKT/NF‑κB/STAT3 pathway uncovered by single-cell RNA sequencing[J]. Phytomedicine, 2023, 120: 155052.
32	Kim SM, Park S, Hwang SH, et al. Secreted Akkermansia muciniphila threonyl-tRNA synthetase functions to monitor and modulate immune homeostasis[J]. Cell Host Microbe, 2023, 31(6): 1021-37.e10.
33	Ma WJ, Long JL, Dong LJ, et al. Uncovering the key pharmacodynamic material basis and possible molecular mechanism of Xiaoke formulation improve insulin resistant through a comprehensive investigation[J]. J Ethnopharmacol, 2024, 323: 117752.
34	Stein J, Aksan A, Farrag K, et al. Management of inflammatory bowel disease-related anemia and iron deficiency with specific reference to the role of intravenous iron in current practice[J]. Expert Opin Pharmacother, 2017, 18(16): 1721-37.
35	Guo BJ, Bian ZX, Qiu HC, et al. Biological and clinical implications of herbal medicine and natural products for the treatment of inflammatory bowel disease[J]. Ann N Y Acad Sci, 2017, 1401(1): 37-48.
36	Wan P, Zhu XD, Liu XP, et al. Inhibition of neddylation ameliorates DSS-induced colitis[J]. Cell Mol Immunol, 2018, 15(6): 649-50.
37	Mizuta Y, Isomoto H, Takahashi T. Impaired nitrergic innervation in rat colitis induced by dextran sulfate sodium[J]. Gastroenterology, 2000, 118(4): 714-23.

[1]	Jincun FANG, Liwei LIU, Junhao LIN, Fengsheng CHEN. Overexpression of CDHR2 inhibits proliferation of breast cancer cells by inhibiting the PI3K/Akt pathway [J]. Journal of Southern Medical University, 2024, 44(6): 1117-1125.
[2]	Yan WANG, Yuqing RUAN, Can CUI, Xiu WANG. Jiaotaiwan improves brain glucose metabolism in a mouse model of Alzheimer's disease by activating the PI3K/AKT signaling pathway [J]. Journal of Southern Medical University, 2024, 44(5): 894-903.
[3]	SHAO Rongrong, YANG Zi, ZHANG Wenjing, ZHANG Nuo, ZHAO Yajing, ZHANG Xiaofeng, ZUO Lugen, GE Sitang. Pachymic acid protects against Crohn's disease-like intestinal barrier injury and colitis in mice by suppressing intestinal epithelial cell apoptosisviainhibiting PI3K/AKT signaling [J]. Journal of Southern Medical University, 2023, 43(6): 935-942.
[4]	XU Wenqin, YE Jingjing, WANG Fei, CHEN Tianbing. Piroctone olamine disrupts mitochondrial dynamics in glioma cells through the PI3K/AKT pathway [J]. Journal of Southern Medical University, 2023, 43(5): 764-771.
[5]	. Changes of guanylate cyclase C in colon tissues of rats with intestinal injury associated with severe acute pancreatitis [J]. Journal of Southern Medical University, 2021, 41(3): 376-383.
[6]	YAO Yu-chuan¹, CHEN Cun-long¹, WANG Ji-de¹, ZHANG Ya-li¹, JIANG Bo¹, XIONG De-xin². Intestinal permeability of patients with advanced digestive tract malignant tumors [J]. Journal of Southern Medical University, 2004, 24(05): 569-571.